Rh7AG025600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0001839
Physical Location & Seq
Reverse (-)
1728238 .. 1728595
358 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG025600.1

Sequence Viewer

Length: 342 bp
ATGACATACTCAGTAAGAAACCCTCCTGCGAAGAGCAAATATACCCTTCAAATCTACTACGGTGGACACTTTGAAACCGAGAGTGATCCCACTTACCAAAACTATATAGGAGAAGGAGTGATCTGGGTTGAAAATCTTGATTATTCGAGAAGGGCTTGTTTGAGTGTTGTCAATGATCTTGCACAGAAGCTGGGCTACCAAAATACTCCAGAAATATATATTTGGCATAAAGGACGGCCGTTGAAAATTACTTCTCACGATGATGTAACAGAAACGATTAGTCAATTGGGAGCTAATCGAGAGTTGATAATGTATATTGTTGGGGATAGAGAAGAGGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

13.02

Weight (kDa)

5.28

Isoelectric Point (pI)

40.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PB1-like PF26130 12 - 103 2.6e-06 PB1-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcoI YGGCCR 1 cut(s) 236
AgsI TTSAA 4 cut(s) 50, 74, 131, 244
AluBI AGCT 2 cut(s) 190, 293
AluI AGCT 2 cut(s) 190, 293
AlwI GGATC 1 cut(s) 80
AlwNI CAGNNNCTG 1 cut(s) 190
AoxI GGCC 1 cut(s) 236
BarI GAAGNNNNNNTAC 2 cut(s) 179, 211
BceAI ACGGC 2 cut(s) 223, 251
BpmI CTGGAG 1 cut(s) 192
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
BseMII CTCAG 1 cut(s) 24
BseX3I CGGCCG 1 cut(s) 236
BseYI CCCAGC 1 cut(s) 190
Bsh1285I CGRYCG 1 cut(s) 239
BshFI GGCC 1 cut(s) 238
BsiEI CGRYCG 1 cut(s) 239
BsnI GGCC 1 cut(s) 238
Bsp143I GATC 3 cut(s) 85, 120, 175
BspANI GGCC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 23
BspPI GGATC 1 cut(s) 80
BspQI GCTCTTC 1 cut(s) 26
BssMI GATC 3 cut(s) 85, 120, 175
Bst4CI ACNGT 1 cut(s) 62
Bst6I CTCTTC 2 cut(s) 26, 327
BstDEI CTNAG 1 cut(s) 10
BstKTI GATC 3 cut(s) 88, 123, 178
BstMBI GATC 3 cut(s) 85, 120, 175
BstMCI CGRYCG 1 cut(s) 239
BstZI CGGCCG 1 cut(s) 236
BsuRI GGCC 1 cut(s) 238
CaiI CAGNNNCTG 1 cut(s) 190
CviJI RGCY 5 cut(s) 155, 190, 195, 238, 293
CviKI_1 RGCY 5 cut(s) 155, 190, 195, 238, 293
DdeI CTNAG 1 cut(s) 10
DpnI GATC 3 cut(s) 87, 122, 177
DpnII GATC 3 cut(s) 85, 120, 175
EaeI YGGCCR 1 cut(s) 236
EagI CGGCCG 1 cut(s) 236
Eam1104I CTCTTC 2 cut(s) 26, 327
EarI CTCTTC 2 cut(s) 26, 327
EclXI CGGCCG 1 cut(s) 236
Eco52I CGGCCG 1 cut(s) 236
FaiI YATR 8 cut(s) 7, 42, 105, 107, 217, 219, 228, 315
GsaI CCCAGC 1 cut(s) 194
GsuI CTGGAG 1 cut(s) 192
HaeIII GGCC 1 cut(s) 238
Hpy166II GTNNAC 1 cut(s) 65
Hpy188III TCNNGA 5 cut(s) 137, 147, 209, 257, 299
Hpy8I GTNNAC 1 cut(s) 65
HpyAV CCTTC 3 cut(s) 56, 107, 144
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 182
HpyF3I CTNAG 1 cut(s) 10
Kzo9I GATC 3 cut(s) 85, 120, 175
LguI GCTCTTC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 290
LpnPI CCDG 4 cut(s) 39, 109, 176, 222
MaeIII GTNAC 1 cut(s) 265
MalI GATC 3 cut(s) 87, 122, 177
MboI GATC 3 cut(s) 85, 120, 175
MboII GAAGA 1 cut(s) 43
MfeI CAATTG 1 cut(s) 284
MluCI AATT 2 cut(s) 246, 284
MnlI CCTC 2 cut(s) 33, 328
MslI CAYNNNNRTG 1 cut(s) 261
MunI CAATTG 1 cut(s) 284
NdeII GATC 3 cut(s) 85, 120, 175
PciSI GCTCTTC 1 cut(s) 26
PspFI CCCAGC 1 cut(s) 190
PstNI CAGNNNCTG 1 cut(s) 190
RseI CAYNNNNRTG 1 cut(s) 261
SapI GCTCTTC 1 cut(s) 26
Sau3AI GATC 3 cut(s) 85, 120, 175
SetI ASST 2 cut(s) 192, 295
SmiMI CAYNNNNRTG 1 cut(s) 261
Sse9I AATT 2 cut(s) 246, 284
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 2 cut(s) 146, 298
TasI AATT 2 cut(s) 246, 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.