AT1G66235

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0001696
Physical Location & Seq
Reverse (-)
24682907 .. 24683996
1090 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G66235.2

Sequence Viewer

Length: 855 bp
ATGCCTCGTTCTACTGGATATTCTAACGAAGAAGATAAGTTTTTATGTCAAGTTTATATGGATATTTCTCAAGATCCAATCATCGGTGTTTACCAATCCTCTGACCATTTTTGGGATCGCGTGGCAGAATCTTTCGAAAATAGAAAAAATCCAACTTGGAGTAAACGTTCAAAAAAATCTCTCCAGTGTCGATTACAAACTATTGAGAAAGCTAGCAAAAAATTACATGCATGCATCAAACTATGTGAAAATCGACGTTCTAGTGGTGCGTCAAGTGATGATATATTCAATCAAGCAAAAGAAATGCTAATGCAAGATAAACATTTCAAATCTGGTTGGAAATTTGATCATGTATGGAACATTATTAGAAACTTTGAAAAGTTTAAAGATGGTGCTACTCAAGCTAAAAAAGTCTTAAATCTATGCGGATTAGAAAATCCTACCCTCGATTCTGTTTCACAAGCGTCTTCAGGTTCGTTTTCATTTTCTCTTAACTTAGATGATGAAGATGACATTATTGGAAGATCTCCATATCAACGACCAATTAGAGTGAAAAAGTCAAAATTGAAAAGAAAAAATGATCAAATATTGGATGTTATCAAGACTTTCGAAGAAGGGAATAAACAACTCATGGAGCAATTAAAGAAGACAAGTGCACAAAGACAACAATATTTGGAGATGCAAAGTAAGAGTTTAGCATTGAGAGAACAAAAAGAAGAAAACAAAGTTTTATATCGAAACTTAAATTCCATAGAAGATCCAAATCTCCGTGCATATCTTCAATCTGAACAAGCAAAAATCTTAAGAAAAAGACTTGATCAACAAGCTGCATCGACATCTACTTCCTTTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

284

Amino Acids

32.99

Weight (kDa)

9.32

Isoelectric Point (pI)

54.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 31 - 185 1.8e-14 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 120
AciI CCGC 1 cut(s) 426
AclI AACGTT 1 cut(s) 166
AclWI GGATC 3 cut(s) 68, 123, 752
AcsI RAATTY 2 cut(s) 341, 745
AcuI CTGAAG 1 cut(s) 453
AfiI CCNNNNNNNGG 2 cut(s) 83, 112
AflII CTTAAG 1 cut(s) 802
AgsI TTSAA 6 cut(s) 171, 289, 328, 377, 568, 782
AloI GAACNNNNNNTCC 2 cut(s) 151, 183
AluBI AGCT 3 cut(s) 212, 404, 827
AluI AGCT 3 cut(s) 212, 404, 827
Alw21I GWGCWC 1 cut(s) 658
Alw44I GTGCAC 1 cut(s) 654
AlwI GGATC 3 cut(s) 68, 123, 752
ApaLI GTGCAC 1 cut(s) 654
ApeKI GCWGC 1 cut(s) 827
ApoI RAATTY 2 cut(s) 341, 745
AsuII TTCGAA 2 cut(s) 135, 609
AsuNHI GCTAGC 1 cut(s) 212
BaeGI GKGCMC 1 cut(s) 658
BbsI GAAGAC 2 cut(s) 459, 653
Bbv12I GWGCWC 1 cut(s) 658
BbvI GCAGC 1 cut(s) 814
BccI CCATC 1 cut(s) 383
BclI TGATCA 3 cut(s) 346, 580, 817
BfaI CTAG 2 cut(s) 213, 261
BfrI CTTAAG 1 cut(s) 802
BglII AGATCT 1 cut(s) 524
BisI GCNGC 1 cut(s) 828
BlsI GCNGC 1 cut(s) 829
BmsI GCATC 3 cut(s) 243, 669, 839
BmtI GCTAGC 1 cut(s) 216
BpiI GAAGAC 2 cut(s) 459, 653
BpmI CTGGAG 1 cut(s) 167
Bpu14I TTCGAA 2 cut(s) 135, 609
BpuEI CTTGAG 2 cut(s) 54, 384
BsaBI GATNNNNATC 1 cut(s) 762
BsaXI ACNNNNNCTCC 2 cut(s) 151, 181
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 112
Bse1I ACTGG 2 cut(s) 19, 184
Bse8I GATNNNNATC 1 cut(s) 762
BseGI GGATG 1 cut(s) 598
BseJI GATNNNNATC 1 cut(s) 762
BseLI CCNNNNNNNGG 2 cut(s) 83, 112
BseNI ACTGG 2 cut(s) 19, 184
BseSI GKGCMC 1 cut(s) 658
BseXI GCAGC 1 cut(s) 814
Bsh1236I CGCG 1 cut(s) 120
BsiHKAI GWGCWC 1 cut(s) 658
BslI CCNNNNNNNGG 2 cut(s) 83, 112
Bsp119I TTCGAA 2 cut(s) 135, 609
Bsp1286I GDGCHC 1 cut(s) 658
Bsp143I GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
BspACI CCGC 1 cut(s) 426
BspFNI CGCG 1 cut(s) 120
BspOI GCTAGC 1 cut(s) 216
BspPI GGATC 3 cut(s) 68, 123, 752
BspT104I TTCGAA 2 cut(s) 135, 609
BspTI CTTAAG 1 cut(s) 802
BsrI ACTGG 2 cut(s) 19, 184
BssMI GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
BstAFI CTTAAG 1 cut(s) 802
BstBI TTCGAA 2 cut(s) 135, 609
BstC8I GCNNGC 2 cut(s) 214, 232
BstDEI CTNAG 1 cut(s) 496
BstF5I GGATG 1 cut(s) 598
BstFNI CGCG 1 cut(s) 120
BstKTI GATC 7 cut(s) 76, 118, 349, 527, 583, 760, 820
BstMBI GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
BstMWI GCNNNNNNNGC 1 cut(s) 401
BstNSI RCATGY 2 cut(s) 230, 234
BstSLI GKGCMC 1 cut(s) 658
BstUI CGCG 1 cut(s) 120
BstV1I GCAGC 1 cut(s) 814
BstV2I GAAGAC 2 cut(s) 459, 653
BstX2I RGATCY 3 cut(s) 73, 524, 757
BstYI RGATCY 3 cut(s) 73, 524, 757
BtsCI GGATG 1 cut(s) 598
BtsIMutI CAGTG 1 cut(s) 191
Cac8I GCNNGC 2 cut(s) 214, 232
CseI GACGC 2 cut(s) 258, 453
CviAII CATG 4 cut(s) 227, 231, 350, 631
CviJI RGCY 3 cut(s) 212, 404, 827
CviKI_1 RGCY 3 cut(s) 212, 404, 827
DdeI CTNAG 1 cut(s) 496
DpnI GATC 7 cut(s) 75, 117, 348, 526, 582, 759, 819
DpnII GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
DraI TTTAAA 1 cut(s) 385
Eco57I CTGAAG 1 cut(s) 453
EcoT22I ATGCAT 2 cut(s) 232, 236
FaeI CATG 4 cut(s) 230, 234, 353, 634
FatI CATG 4 cut(s) 226, 230, 349, 630
FbaI TGATCA 3 cut(s) 346, 580, 817
Fnu4HI GCNGC 1 cut(s) 828
FokI GGATG 1 cut(s) 605
Fsp4HI GCNGC 1 cut(s) 828
FspBI CTAG 2 cut(s) 213, 261
GluI GCNGC 1 cut(s) 828
GsuI CTGGAG 1 cut(s) 167
HgaI GACGC 2 cut(s) 258, 453
Hin1II CATG 4 cut(s) 230, 234, 353, 634
HinfI GANTC 2 cut(s) 128, 449
Hpy166II GTNNAC 3 cut(s) 91, 164, 656
Hpy188I TCNGA 2 cut(s) 103, 787
Hpy188III TCNNGA 2 cut(s) 71, 601
Hpy8I GTNNAC 3 cut(s) 91, 164, 656
Hpy99I CGWCG 1 cut(s) 258
HpyAV CCTTC 1 cut(s) 608
HpyCH4IV ACGT 2 cut(s) 166, 256
HpyCH4V TGCA 7 cut(s) 230, 234, 313, 656, 682, 773, 830
HpyF10VI GCNNNNNNNGC 1 cut(s) 401
HpyF3I CTNAG 1 cut(s) 496
HpySE526I ACGT 2 cut(s) 166, 256
Hsp92II CATG 4 cut(s) 230, 234, 353, 634
Ksp22I TGATCA 3 cut(s) 346, 580, 817
Kzo9I GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
LmnI GCTCC 1 cut(s) 634
LpnPI CCDG 3 cut(s) 197, 318, 456
Lsp1109I GCAGC 1 cut(s) 814
LweI GCATC 3 cut(s) 243, 669, 839
MaeI CTAG 2 cut(s) 213, 261
MaeII ACGT 2 cut(s) 166, 256
MalI GATC 7 cut(s) 75, 117, 348, 526, 582, 759, 819
MboI GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
MflI RGATCY 3 cut(s) 73, 524, 757
MhlI GDGCHC 1 cut(s) 658
MluCI AATT 6 cut(s) 221, 341, 543, 563, 638, 745
MmeI TCCRAC 2 cut(s) 176, 317
MnlI CCTC 3 cut(s) 15, 109, 455
Mph1103I ATGCAT 2 cut(s) 232, 236
MseI TTAA 7 cut(s) 384, 416, 492, 641, 743, 803, 853
MspCI CTTAAG 1 cut(s) 802
MvnI CGCG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 401
NdeII GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
NheI GCTAGC 1 cut(s) 212
NlaIII CATG 4 cut(s) 230, 234, 353, 634
NsiI ATGCAT 2 cut(s) 232, 236
NspI RCATGY 2 cut(s) 230, 234
NspV TTCGAA 2 cut(s) 135, 609
PaeI GCATGC 1 cut(s) 234
PfeI GAWTC 2 cut(s) 128, 449
PkrI GCNGC 1 cut(s) 829
Psp1406I AACGTT 1 cut(s) 166
PsuI RGATCY 3 cut(s) 73, 524, 757
SaqAI TTAA 7 cut(s) 384, 416, 492, 641, 743, 803, 853
SatI GCNGC 1 cut(s) 828
Sau3AI GATC 7 cut(s) 73, 115, 346, 524, 580, 757, 817
SduI GDGCHC 1 cut(s) 658
SetI ASST 6 cut(s) 169, 214, 259, 406, 475, 829
SfaNI GCATC 3 cut(s) 243, 669, 839
SfuI TTCGAA 2 cut(s) 135, 609
SmlI CTYRAG 3 cut(s) 69, 399, 802
SmoI CTYRAG 3 cut(s) 69, 399, 802
SphI GCATGC 1 cut(s) 234
Sse9I AATT 6 cut(s) 221, 341, 543, 563, 638, 745
SsiI CCGC 1 cut(s) 426
SspI AATATT 2 cut(s) 588, 671
SspMI CTAG 2 cut(s) 213, 261
TaiI ACGT 2 cut(s) 169, 259
TaqI TCGA 7 cut(s) 135, 190, 253, 447, 609, 736, 833
TasI AATT 6 cut(s) 221, 341, 543, 563, 638, 745
TfiI GAWTC 2 cut(s) 128, 449
Tru1I TTAA 7 cut(s) 384, 416, 492, 641, 743, 803, 853
Tru9I TTAA 7 cut(s) 384, 416, 492, 641, 743, 803, 853
TscAI CASTG 1 cut(s) 191
TseI GCWGC 1 cut(s) 827
TspDTI ATGAA 2 cut(s) 471, 519
TspGWI ACGGA 1 cut(s) 758
TspRI CASTG 1 cut(s) 191
Vha464I CTTAAG 1 cut(s) 802
VneI GTGCAC 1 cut(s) 654
XapI RAATTY 2 cut(s) 341, 745
XceI RCATGY 2 cut(s) 230, 234
XspI CTAG 2 cut(s) 213, 261
Zsp2I ATGCAT 2 cut(s) 232, 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.