Rh2CG423900

Ribosomal protein-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
57791828 .. 57792692
865 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG423900.1

Sequence Viewer

Length: 342 bp
ATGGTTGTTGATGAAGATGCACGATTTAATAAGTTTCATGCTCGAAATAGGCAAATCAAGGACAAAAATGCTCATTTTGAGCTTCGGGATGCATTGATTGATCATCTATGGGATCGTCATGGTAAAGAACTAAAGATGAAGCTTGAAGATGCGCTATGGGAGAGGATTGCTGTTATCTACAATGAAGATAAGCTTGAGGAAAGGATCAGATTTGGTGGGTCTCTTCAAAGTCGATTTTCTGATCTATGCTTACCAGTCAGTAAACTTCGTGGTCATGTTCGACTAATTGAGTACCAAAATCCAAGTGGTGCGTCAGAATCATATATCGTAAGTATCGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

13.29

Weight (kDa)

6.97

Isoelectric Point (pI)

45.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 120, 212
AfaI GTAC 1 cut(s) 293
AgsI TTSAA 2 cut(s) 146, 227
AluBI AGCT 3 cut(s) 82, 142, 193
AluI AGCT 3 cut(s) 82, 142, 193
Alw26I GTCTC 1 cut(s) 225
AlwI GGATC 2 cut(s) 120, 212
AspLEI GCGC 1 cut(s) 154
BclI TGATCA 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 225
BmsI GCATC 3 cut(s) 7, 79, 139
BpuEI CTTGAG 1 cut(s) 215
BsaI GGTCTC 1 cut(s) 225
Bse1I ACTGG 1 cut(s) 254
BseGI GGATG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 254
BsmAI GTCTC 1 cut(s) 225
Bso31I GGTCTC 1 cut(s) 225
Bsp143I GATC 4 cut(s) 100, 112, 204, 241
BspPI GGATC 2 cut(s) 120, 212
BspTNI GGTCTC 1 cut(s) 225
BsrI ACTGG 1 cut(s) 254
BssMI GATC 4 cut(s) 100, 112, 204, 241
Bst6I CTCTTC 1 cut(s) 228
BstF5I GGATG 1 cut(s) 94
BstHHI GCGC 1 cut(s) 154
BstKTI GATC 4 cut(s) 103, 115, 207, 244
BstMAI GTCTC 1 cut(s) 225
BstMBI GATC 4 cut(s) 100, 112, 204, 241
BtsCI GGATG 1 cut(s) 94
CfoI GCGC 1 cut(s) 154
CseI GACGC 1 cut(s) 300
Csp6I GTAC 1 cut(s) 292
CviAII CATG 3 cut(s) 38, 119, 275
CviJI RGCY 3 cut(s) 82, 142, 193
CviKI_1 RGCY 3 cut(s) 82, 142, 193
CviQI GTAC 1 cut(s) 292
DpnI GATC 4 cut(s) 102, 114, 206, 243
DpnII GATC 4 cut(s) 100, 112, 204, 241
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco31I GGTCTC 1 cut(s) 225
EcoT22I ATGCAT 1 cut(s) 94
FaeI CATG 3 cut(s) 41, 122, 278
FaiI YATR 9 cut(s) 39, 109, 120, 157, 247, 276, 322, 324, 340
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FatI CATG 3 cut(s) 37, 118, 274
FbaI TGATCA 1 cut(s) 100
FokI GGATG 1 cut(s) 101
GlaI GCGC 1 cut(s) 153
HgaI GACGC 1 cut(s) 300
HhaI GCGC 1 cut(s) 154
Hin1II CATG 3 cut(s) 41, 122, 278
Hin6I GCGC 1 cut(s) 152
HinP1I GCGC 1 cut(s) 152
HindIII AAGCTT 2 cut(s) 140, 191
HinfI GANTC 1 cut(s) 317
Hpy166II GTNNAC 1 cut(s) 263
Hpy188I TCNGA 3 cut(s) 209, 241, 316
Hpy188III TCNNGA 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 263
HpyCH4V TGCA 2 cut(s) 20, 92
Hsp92II CATG 3 cut(s) 41, 122, 278
HspAI GCGC 1 cut(s) 152
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 4 cut(s) 100, 112, 204, 241
LpnPI CCDG 1 cut(s) 267
LweI GCATC 3 cut(s) 7, 79, 139
MalI GATC 4 cut(s) 102, 114, 206, 243
MboI GATC 4 cut(s) 100, 112, 204, 241
MboII GAAGA 4 cut(s) 26, 158, 197, 215
MluCI AATT 1 cut(s) 285
MnlI CCTC 2 cut(s) 156, 190
Mph1103I ATGCAT 1 cut(s) 94
MseI TTAA 1 cut(s) 27
NdeII GATC 4 cut(s) 100, 112, 204, 241
NlaIII CATG 3 cut(s) 41, 122, 278
NsiI ATGCAT 1 cut(s) 94
PfeI GAWTC 1 cut(s) 317
RsaI GTAC 1 cut(s) 293
RsaNI GTAC 1 cut(s) 292
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 4 cut(s) 100, 112, 204, 241
SetI ASST 3 cut(s) 84, 144, 195
SfaNI GCATC 3 cut(s) 7, 79, 139
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 1 cut(s) 285
TaqI TCGA 3 cut(s) 43, 232, 280
TasI AATT 1 cut(s) 285
TfiI GAWTC 1 cut(s) 317
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TspDTI ATGAA 4 cut(s) 26, 27, 152, 198
XcmI CCANNNNNNNNNTGG 1 cut(s) 302
Zsp2I ATGCAT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.