FvH4_1g29461

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
OG0001696
Physical Location & Seq
Reverse (-)
22559827 .. 22560585
759 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g29461.t1

Sequence Viewer

Length: 672 bp
ATGGCAGATGTTAGGCAAAAGAAAGTTGTCCAACAAAAAGGAAATTTTTCGATCCAAGAAGATGAACTCTTATGTCATATATATCTTGAAATTTCTCAAGATCCTATCGATGGTGTTAACCAAAAGAAGGATAAAGTATGGGCGAGGATCACTGAATTGTGGAATCAAGATAAGGATGAGAATCAGACGAGAACATCCAAGTCTCTTCAAAGTCGATTTGTAGATCTTACTTACTGTGTAAGCAAATTTCGTGGTGTTGTTCGTCAAGTGGAGGATGACAATCCAAGCGGTGCAAATGAGAAAGATATTTGTGCCAAAGCAAAACAAATTCTACTAGATGATCCTAACTTCACAAAGAAGAAACTTCAGTTTGATCATGTGTGGCATATTCTTAAGGATGCTGAAAAGTGGGCCGATACTGGTAGAAGTTCAACAAGACCACGACAAAGAAATTATTCAAGTGAAGGATATGAATTAGCGTCTCGCACATCACAATCGTCAGGTACACTACCATTTGATGTCGATTTAAATGCAGATGAAGACGAACAAGAGCTATATAATGATGAACTCGACACGTCTCGTCGACCCATTGGTGTAAAGAAAGCAAAGCTGAAAAGGAAAGAGGCCAATGAGCAGACCAAGATTGCTAAACAAATCAGAGAATCCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

224

Amino Acids

25.84

Weight (kDa)

6.85

Isoelectric Point (pI)

47.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 120 - 220 4.7e-11 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 583
AciI CCGC 1 cut(s) 288
AclWI GGATC 4 cut(s) 46, 95, 155, 335
AcsI RAATTY 4 cut(s) 43, 90, 245, 327
AcuI CTGAAG 1 cut(s) 350
AfaI GTAC 1 cut(s) 505
AfiI CCNNNNNNNGG 2 cut(s) 110, 127
AflII CTTAAG 1 cut(s) 392
AflIII ACRYGT 1 cut(s) 573
AgsI TTSAA 4 cut(s) 89, 209, 432, 459
AjiI CACGTC 1 cut(s) 576
AluBI AGCT 2 cut(s) 553, 610
AluI AGCT 2 cut(s) 553, 610
Alw26I GTCTC 3 cut(s) 207, 486, 582
AlwI GGATC 4 cut(s) 46, 95, 155, 335
AoxI GGCC 2 cut(s) 411, 624
ApoI RAATTY 4 cut(s) 43, 90, 245, 327
Asp700I GAANNNNTTC 2 cut(s) 46, 454
AspS9I GGNCC 1 cut(s) 411
BbsI GAAGAC 1 cut(s) 546
BccI CCATC 1 cut(s) 104
BcgI CGANNNNNNTGC 2 cut(s) 512, 546
BclI TGATCA 1 cut(s) 373
BcoDI GTCTC 3 cut(s) 207, 486, 582
BfaI CTAG 1 cut(s) 335
BfrI CTTAAG 1 cut(s) 392
BglII AGATCT 1 cut(s) 223
BmgBI CACGTC 1 cut(s) 576
BmgT120I GGNCC 1 cut(s) 411
BmsI GCATC 1 cut(s) 388
BpiI GAAGAC 1 cut(s) 546
BpuEI CTTGAG 1 cut(s) 81
Bsa29I ATCGAT 1 cut(s) 108
BsaBI GATNNNNATC 2 cut(s) 180, 279
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 127
Bse1I ACTGG 1 cut(s) 424
Bse8I GATNNNNATC 2 cut(s) 180, 279
BseCI ATCGAT 1 cut(s) 108
BseGI GGATG 4 cut(s) 181, 194, 280, 403
BseJI GATNNNNATC 2 cut(s) 180, 279
BseLI CCNNNNNNNGG 2 cut(s) 110, 127
BseNI ACTGG 1 cut(s) 424
BshFI GGCC 2 cut(s) 413, 626
BshVI ATCGAT 1 cut(s) 108
BslI CCNNNNNNNGG 2 cut(s) 110, 127
BsmAI GTCTC 3 cut(s) 207, 486, 582
BsmBI CGTCTC 2 cut(s) 486, 582
BsnI GGCC 2 cut(s) 413, 626
Bsp143I GATC 6 cut(s) 51, 100, 147, 223, 340, 373
BspACI CCGC 1 cut(s) 288
BspANI GGCC 2 cut(s) 413, 626
BspDI ATCGAT 1 cut(s) 108
BspPI GGATC 4 cut(s) 46, 95, 155, 335
BspTI CTTAAG 1 cut(s) 392
BsrI ACTGG 1 cut(s) 424
BssMI GATC 6 cut(s) 51, 100, 147, 223, 340, 373
Bst4CI ACNGT 1 cut(s) 236
Bst6I CTCTTC 1 cut(s) 210
BstAFI CTTAAG 1 cut(s) 392
BstF5I GGATG 4 cut(s) 181, 194, 280, 403
BstKTI GATC 6 cut(s) 54, 103, 150, 226, 343, 376
BstMAI GTCTC 3 cut(s) 207, 486, 582
BstMBI GATC 6 cut(s) 51, 100, 147, 223, 340, 373
BstV2I GAAGAC 1 cut(s) 546
BstX2I RGATCY 2 cut(s) 100, 223
BstYI RGATCY 2 cut(s) 100, 223
Bsu15I ATCGAT 1 cut(s) 108
BsuRI GGCC 2 cut(s) 413, 626
BsuTUI ATCGAT 1 cut(s) 108
BtrI CACGTC 1 cut(s) 576
BtsCI GGATG 4 cut(s) 181, 194, 280, 403
BtsIMutI CAGTG 1 cut(s) 150
Cfr13I GGNCC 1 cut(s) 411
ClaI ATCGAT 1 cut(s) 108
CseI GACGC 1 cut(s) 468
Csp6I GTAC 1 cut(s) 504
CspCI CAANNNNNGTGG 2 cut(s) 232, 267
CviAII CATG 1 cut(s) 377
CviJI RGCY 4 cut(s) 413, 553, 610, 626
CviKI_1 RGCY 4 cut(s) 413, 553, 610, 626
CviQI GTAC 1 cut(s) 504
DpnI GATC 6 cut(s) 53, 102, 149, 225, 342, 375
DpnII GATC 6 cut(s) 51, 100, 147, 223, 340, 373
DraI TTTAAA 1 cut(s) 528
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco57I CTGAAG 1 cut(s) 350
Esp3I CGTCTC 2 cut(s) 486, 582
FaeI CATG 1 cut(s) 380
FatI CATG 1 cut(s) 376
FbaI TGATCA 1 cut(s) 373
FblI GTMKAC 1 cut(s) 583
FokI GGATG 4 cut(s) 181, 188, 287, 410
FspBI CTAG 1 cut(s) 335
HaeIII GGCC 2 cut(s) 413, 626
HgaI GACGC 1 cut(s) 468
Hin1II CATG 1 cut(s) 380
HincII GTYRAC 2 cut(s) 118, 584
HindII GTYRAC 2 cut(s) 118, 584
HinfI GANTC 3 cut(s) 163, 181, 662
HpaI GTTAAC 1 cut(s) 118
Hpy166II GTNNAC 3 cut(s) 118, 506, 584
Hpy188I TCNGA 2 cut(s) 186, 659
Hpy188III TCNNGA 3 cut(s) 86, 98, 167
Hpy8I GTNNAC 3 cut(s) 118, 506, 584
Hpy99I CGWCG 1 cut(s) 585
HpyAV CCTTC 2 cut(s) 121, 458
HpyCH4III ACNGT 1 cut(s) 236
HpyCH4IV ACGT 1 cut(s) 575
HpyCH4V TGCA 2 cut(s) 293, 533
HpySE526I ACGT 1 cut(s) 575
Hsp92II CATG 1 cut(s) 380
Ksp22I TGATCA 1 cut(s) 373
KspAI GTTAAC 1 cut(s) 118
Kzo9I GATC 6 cut(s) 51, 100, 147, 223, 340, 373
LpnPI CCDG 2 cut(s) 405, 486
LweI GCATC 1 cut(s) 388
MaeI CTAG 1 cut(s) 335
MaeII ACGT 1 cut(s) 575
MalI GATC 6 cut(s) 53, 102, 149, 225, 342, 375
MboI GATC 6 cut(s) 51, 100, 147, 223, 340, 373
MboII GAAGA 4 cut(s) 71, 197, 370, 551
MflI RGATCY 2 cut(s) 100, 223
MluCI AATT 8 cut(s) 43, 90, 155, 245, 327, 451, 473, 667
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 3 cut(s) 138, 265, 616
MroXI GAANNNNTTC 2 cut(s) 46, 454
MseI TTAA 4 cut(s) 117, 393, 527, 670
MspCI CTTAAG 1 cut(s) 392
NdeII GATC 6 cut(s) 51, 100, 147, 223, 340, 373
NlaIII CATG 1 cut(s) 380
PdmI GAANNNNTTC 2 cut(s) 46, 454
PfeI GAWTC 3 cut(s) 163, 181, 662
PspPI GGNCC 1 cut(s) 411
PsuI RGATCY 2 cut(s) 100, 223
RsaI GTAC 1 cut(s) 505
RsaNI GTAC 1 cut(s) 504
SalI GTCGAC 1 cut(s) 582
SaqAI TTAA 4 cut(s) 117, 393, 527, 670
Sau3AI GATC 6 cut(s) 51, 100, 147, 223, 340, 373
Sau96I GGNCC 1 cut(s) 411
SetI ASST 4 cut(s) 505, 555, 578, 612
SfaNI GCATC 1 cut(s) 388
SmiI ATTTAAAT 1 cut(s) 528
SmlI CTYRAG 2 cut(s) 96, 392
SmoI CTYRAG 2 cut(s) 96, 392
Sse9I AATT 8 cut(s) 43, 90, 155, 245, 327, 451, 473, 667
SsiI CCGC 1 cut(s) 288
SspMI CTAG 1 cut(s) 335
SwaI ATTTAAAT 1 cut(s) 528
TaaI ACNGT 1 cut(s) 236
TaiI ACGT 1 cut(s) 578
TaqI TCGA 6 cut(s) 50, 108, 214, 522, 570, 583
TasI AATT 8 cut(s) 43, 90, 155, 245, 327, 451, 473, 667
TfiI GAWTC 3 cut(s) 163, 181, 662
Tru1I TTAA 4 cut(s) 117, 393, 527, 670
Tru9I TTAA 4 cut(s) 117, 393, 527, 670
TscAI CASTG 1 cut(s) 157
TspDTI ATGAA 4 cut(s) 78, 486, 552, 579
TspRI CASTG 1 cut(s) 157
Vha464I CTTAAG 1 cut(s) 392
XapI RAATTY 4 cut(s) 43, 90, 245, 327
XmiI GTMKAC 1 cut(s) 583
XmnI GAANNNNTTC 2 cut(s) 46, 454
XspI CTAG 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.