Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003767.1

Orthogroup ID

OG0001696

Physical Location & Seq

Genomic Coordinates Reverse (-)

13044 .. 14075

Gene Structure 1032 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003767.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 765 bp

atgaaggcaagtctgaggaaaggagtaaatctggtgggtcgcttcaaagtcaattttctaatctatgctaccgagaaattgcttgataatgctgccatgaccgttcctaaacctcgtagaagaaaagagtcatatgaaggatctcaatcaggttctcgcacatcaaggacatctgatactccatcgttttctgttgatttaaatgtagatgaagatgagcaagagtacatcaacgatgaagttgcttcacatgatcgtcccatgggaacgaagatggcaaagatgaaatggaaagccaccgatgagaagaaaaagaattatgataagatcatggccgataacaaagcaataaaagagttacttgaaaaaattatgctggagagatcaagcttcgcttccaagtttgaccattacacgtcaagcaacttggatattcaacgtcagcacgaagagaataaaatcatgctgactaatttgaattccataatagatccaacaaaccatgaattcttgaagaagaggaaggcagaagttatgcaaagaagagcttatgagtctcaatcacaaggatcaccacctactacatttggctatggtaactttagtaacctgaaccagtttcaaagtggttctgaagctacatttcgttctggaaattttggtagtcctttacaattttcaagtggattcggaggaagtggtgggagtggagaagtaccacatgctggaggaagtagtgggtttggaacaagtagcggtggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM-associated

Protein Analysis

254

Amino Acids

28.2

Weight (kDa)

9.2

Isoelectric Point (pI)

48.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001696)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G24380 AT1G66235 AT1G66235 AT2G13760 AT4G10230
fragaria_vesca	FvH4_1g29460 FvH4_1g29461 FvH4_2g00671 FvH4_2g02401 FvH4_4g12912 FvH4_5g16793 FvH4_5g35255 FvH4_6g21850
rosa_laevigata	RLG00000001802 RLG00000007297 RLG00000009939 RLG00000014129 RLG00000020485 RLG00000020868 RLG00000022589 RLG00000026627
rosa_multiflora	Rmu_co8293213.1_g000001 Rmu_co8323109.1_g000001 Rmu_sc0000149.1_g000032 Rmu_sc0000775.1_g000012 Rmu_sc0000776.1_g000009 Rmu_sc0001872.1_g000007 Rmu_sc0002666.1_g000024 Rmu_sc0003767.1_g000003 Rmu_sc0006410.1_g000019 Rmu_sc0006797.1_g000002 Rmu_sc0014826.1_g000002 Rmu_sc0015243.1_g000005 Rmu_sc0033419.1_g000002
rosa_roxburghii	Rroxscaffold_4G00296630 Rroxscaffold_7G00202090
rosa_samantha	Rh1BG046500 Rh2CG257500 Rh2CG423800 Rh2CG423900 Rh4BG046900 Rh4BG047000 Rh4BG078300 Rh5CG060500 Rh5CG341400 Rh6DG172800 Rh7BG334200
rosa_wichuraiana	Rw7G024310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	725
AciI	CCGC	1 cut(s)	756
AclWI	GGATC	3 cut(s)	148, 485, 577
AcoI	YGGCCR	1 cut(s)	333
AcsI	RAATTY	3 cut(s)	478, 506, 655
AcuI	CTGAAG	1 cut(s)	654
AfaI	GTAC	2 cut(s)	227, 717
AfiI	CCNNNNNNNGG	1 cut(s)	725
AflIII	ACRYGT	1 cut(s)	414
AgsI	TTSAA	7 cut(s)	46, 365, 437, 478, 514, 623, 681
AjiI	CACGTC	1 cut(s)	417
AluBI	AGCT	3 cut(s)	390, 548, 638
AluI	AGCT	3 cut(s)	390, 548, 638
Alw26I	GTCTC	1 cut(s)	561
AlwI	GGATC	3 cut(s)	148, 485, 577
AoxI	GGCC	1 cut(s)	333
ApeKI	GCWGC	1 cut(s)	92
ApoI	RAATTY	3 cut(s)	478, 506, 655
AsuHPI	GGTGA	1 cut(s)	564
BbvI	GCAGC	1 cut(s)	79
BccI	CCATC	2 cut(s)	190, 268
BcgI	CGANNNNNNTGC	2 cut(s)	224, 258
BcoDI	GTCTC	1 cut(s)	561
BisI	GCNGC	1 cut(s)	93
BlsI	GCNGC	1 cut(s)	94
BmgBI	CACGTC	1 cut(s)	417
BpmI	CTGGAG	2 cut(s)	398, 747
BsaBI	GATNNNNATC	1 cut(s)	145
BsaJI	CCNNGG	1 cut(s)	261
Bsc4I	CCNNNNNNNGG	1 cut(s)	725
Bse1I	ACTGG	1 cut(s)	616
Bse8I	GATNNNNATC	1 cut(s)	145
BseDI	CCNNGG	1 cut(s)	261
BseJI	GATNNNNATC	1 cut(s)	145
BseLI	CCNNNNNNNGG	1 cut(s)	725
BseMII	CTCAG	1 cut(s)	5
BseNI	ACTGG	1 cut(s)	616
BseXI	GCAGC	1 cut(s)	79
BshFI	GGCC	1 cut(s)	335
BslFI	GGGAC	1 cut(s)	243
BslI	CCNNNNNNNGG	1 cut(s)	725
BsmAI	GTCTC	1 cut(s)	561
BsmFI	GGGAC	1 cut(s)	243
BsnI	GGCC	1 cut(s)	335
Bsp143I	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
Bsp19I	CCATGG	1 cut(s)	261
BspACI	CCGC	1 cut(s)	756
BspANI	GGCC	1 cut(s)	335
BspCNI	CTCAG	1 cut(s)	6
BspPI	GGATC	3 cut(s)	148, 485, 577
BspQI	GCTCTTC	1 cut(s)	538
BsrI	ACTGG	1 cut(s)	616
BssECI	CCNNGG	1 cut(s)	261
BssMI	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
BssT1I	CCWWGG	1 cut(s)	261
Bst4CI	ACNGT	1 cut(s)	103
Bst6I	CTCTTC	3 cut(s)	444, 512, 538
BstDEI	CTNAG	1 cut(s)	14
BstDSI	CCRYGG	1 cut(s)	261
BstKTI	GATC	6 cut(s)	143, 256, 330, 386, 493, 572
BstMAI	GTCTC	1 cut(s)	561
BstMBI	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
BstNSI	RCATGY	1 cut(s)	725
BstV1I	GCAGC	1 cut(s)	79
BstX2I	RGATCY	2 cut(s)	140, 490
BstYI	RGATCY	2 cut(s)	140, 490
BsuRI	GGCC	1 cut(s)	335
BtgI	CCRYGG	1 cut(s)	261
BtrI	CACGTC	1 cut(s)	417
Csp6I	GTAC	2 cut(s)	226, 716
CviAII	CATG	7 cut(s)	97, 251, 262, 331, 463, 503, 722
CviJI	RGCY	6 cut(s)	296, 335, 390, 548, 591, 638
CviKI_1	RGCY	6 cut(s)	296, 335, 390, 548, 591, 638
CviQI	GTAC	2 cut(s)	226, 716
DdeI	CTNAG	1 cut(s)	14
DpnI	GATC	6 cut(s)	142, 255, 329, 385, 492, 571
DpnII	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
DraI	TTTAAA	1 cut(s)	201
EaeI	YGGCCR	1 cut(s)	333
Eam1104I	CTCTTC	3 cut(s)	444, 512, 538
EarI	CTCTTC	3 cut(s)	444, 512, 538
Eco130I	CCWWGG	1 cut(s)	261
Eco57I	CTGAAG	1 cut(s)	654
EcoRI	GAATTC	2 cut(s)	478, 506
EcoT14I	CCWWGG	1 cut(s)	261
ErhI	CCWWGG	1 cut(s)	261
FaeI	CATG	7 cut(s)	100, 254, 265, 334, 466, 506, 725
FalI	AAGNNNNNCTT	6 cut(s)	345, 377, 379, 411, 532, 564
FaqI	GGGAC	1 cut(s)	243
FatI	CATG	7 cut(s)	96, 250, 261, 330, 462, 502, 721
FauNDI	CATATG	1 cut(s)	133
Fnu4HI	GCNGC	1 cut(s)	93
Fsp4HI	GCNGC	1 cut(s)	93
GluI	GCNGC	1 cut(s)	93
GsuI	CTGGAG	2 cut(s)	398, 747
HaeIII	GGCC	1 cut(s)	335
Hin1II	CATG	7 cut(s)	100, 254, 265, 334, 466, 506, 725
HindIII	AAGCTT	1 cut(s)	388
HinfI	GANTC	3 cut(s)	128, 554, 687
HphI	GGTGA	1 cut(s)	564
Hpy188I	TCNGA	4 cut(s)	15, 175, 634, 692
Hpy188III	TCNNGA	2 cut(s)	511, 651
HpyAV	CCTTC	2 cut(s)	131, 517
HpyCH4III	ACNGT	1 cut(s)	103
HpyCH4IV	ACGT	2 cut(s)	416, 439
HpyCH4V	TGCA	1 cut(s)	538
HpyF3I	CTNAG	1 cut(s)	14
HpySE526I	ACGT	2 cut(s)	416, 439
Hsp92II	CATG	7 cut(s)	100, 254, 265, 334, 466, 506, 725
Kzo9I	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
LguI	GCTCTTC	1 cut(s)	538
LpnPI	CCDG	7 cut(s)	17, 135, 362, 623, 629, 636, 711
Lsp1109I	GCAGC	1 cut(s)	79
MaeII	ACGT	2 cut(s)	416, 439
MaeIII	GTNAC	3 cut(s)	357, 596, 605
MalI	GATC	6 cut(s)	142, 255, 329, 385, 492, 571
MboI	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
MboII	GAAGA	8 cut(s)	132, 224, 283, 319, 461, 526, 529, 555
MflI	RGATCY	2 cut(s)	140, 490
MluCI	AATT	9 cut(s)	52, 77, 316, 369, 472, 478, 506, 655, 674
MlyI	GAGTC	2 cut(s)	137, 563
MmeI	TCCRAC	1 cut(s)	518
MnlI	CCTC	5 cut(s)	9, 123, 513, 686, 722
MseI	TTAA	1 cut(s)	200
NcoI	CCATGG	1 cut(s)	261
NdeI	CATATG	1 cut(s)	133
NdeII	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
NlaIII	CATG	7 cut(s)	100, 254, 265, 334, 466, 506, 725
NspI	RCATGY	1 cut(s)	725
PciSI	GCTCTTC	1 cut(s)	538
PfeI	GAWTC	1 cut(s)	687
PflMI	CCANNNNNTGG	1 cut(s)	725
PkrI	GCNGC	1 cut(s)	94
PleI	GAGTC	2 cut(s)	136, 562
PpsI	GAGTC	2 cut(s)	136, 562
PsuI	RGATCY	2 cut(s)	140, 490
RsaI	GTAC	2 cut(s)	227, 717
RsaNI	GTAC	2 cut(s)	226, 716
SapI	GCTCTTC	1 cut(s)	538
SaqAI	TTAA	1 cut(s)	200
SatI	GCNGC	1 cut(s)	93
Sau3AI	GATC	6 cut(s)	140, 253, 327, 383, 490, 569
SchI	GAGTC	2 cut(s)	137, 563
SetI	ASST	9 cut(s)	115, 154, 392, 419, 442, 550, 580, 612, 640
SmiI	ATTTAAAT	1 cut(s)	201
Sse9I	AATT	9 cut(s)	52, 77, 316, 369, 472, 478, 506, 655, 674
SsiI	CCGC	1 cut(s)	756
StyI	CCWWGG	1 cut(s)	261
SwaI	ATTTAAAT	1 cut(s)	201
TaaI	ACNGT	1 cut(s)	103
TaiI	ACGT	2 cut(s)	419, 442
TasI	AATT	9 cut(s)	52, 77, 316, 369, 472, 478, 506, 655, 674
TatI	WGTACW	1 cut(s)	225
TfiI	GAWTC	1 cut(s)	687
Tru1I	TTAA	1 cut(s)	200
Tru9I	TTAA	1 cut(s)	200
TseI	GCWGC	1 cut(s)	92
TspDTI	ATGAA	6 cut(s)	17, 150, 225, 252, 299, 519
Van91I	CCANNNNNTGG	1 cut(s)	725
XapI	RAATTY	3 cut(s)	478, 506, 655
XceI	RCATGY	1 cut(s)	725
XcmI	CCANNNNNNNNNTGG	1 cut(s)	623

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.