Rmu_sc0033419.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033419.1
Physical Location & Seq
Reverse (-)
2008 .. 2310
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033419.1_g000002.1.cds

Sequence Viewer

Length: 303 bp
atgagaacgaagatgacaaagatgaaaaggaaagccaccgatgagaagaaaaagaattatgataagatcatggccaacaaccaagcaataaaagagttacttgaaaaaatgaggttggagagatcaagcttcacttccaagtttgaccattacatgtcaagcaaactggatattcaacgtcagggcaatgagaataaaaccgcatgccctaaacatcacctccaacacctgattcccttgttcagtccgtccaataatcagcggatacaatactgcactgacactttgagtaattcctcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.81

Weight (kDa)

9.87

Isoelectric Point (pI)

64.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 201, 262
AcoI YGGCCR 1 cut(s) 72
AflIII ACRYGT 1 cut(s) 153
AgsI TTSAA 2 cut(s) 104, 176
AjuI GAANNNNNNNTTGG 2 cut(s) 216, 248
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
AoxI GGCC 1 cut(s) 72
AsuHPI GGTGA 1 cut(s) 209
BalI TGGCCA 1 cut(s) 74
BciVI GTATCC 1 cut(s) 258
BfuI GTATCC 1 cut(s) 258
BsaXI ACNNNNNCTCC 2 cut(s) 204, 234
Bse1I ACTGG 1 cut(s) 171
Bse3DI GCAATG 1 cut(s) 193
BseMI GCAATG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 171
BsgI GTGCAG 1 cut(s) 259
BshFI GGCC 1 cut(s) 74
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 66, 122
BspACI CCGC 2 cut(s) 201, 262
BspANI GGCC 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 193
BsrI ACTGG 1 cut(s) 171
BssMI GATC 2 cut(s) 66, 122
BstC8I GCNNGC 1 cut(s) 205
BstKTI GATC 2 cut(s) 69, 125
BstMBI GATC 2 cut(s) 66, 122
BstNSI RCATGY 2 cut(s) 157, 207
BsuI GTATCC 1 cut(s) 258
BsuRI GGCC 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 276
Cac8I GCNNGC 1 cut(s) 205
CviAII CATG 3 cut(s) 70, 154, 204
CviJI RGCY 3 cut(s) 35, 74, 129
CviKI_1 RGCY 3 cut(s) 35, 74, 129
DpnI GATC 2 cut(s) 68, 124
DpnII GATC 2 cut(s) 66, 122
EaeI YGGCCR 1 cut(s) 72
FaeI CATG 3 cut(s) 73, 157, 207
FaiI YATR 5 cut(s) 60, 71, 155, 205, 301
FalI AAGNNNNNCTT 4 cut(s) 84, 116, 118, 150
FatI CATG 3 cut(s) 69, 153, 203
HaeIII GGCC 1 cut(s) 74
Hin1II CATG 3 cut(s) 73, 157, 207
HindIII AAGCTT 1 cut(s) 127
HinfI GANTC 1 cut(s) 232
HphI GGTGA 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 178
HpyCH4V TGCA 1 cut(s) 276
HpySE526I ACGT 1 cut(s) 178
Hsp92II CATG 3 cut(s) 73, 157, 207
Kzo9I GATC 2 cut(s) 66, 122
LpnPI CCDG 3 cut(s) 152, 167, 242
MaeII ACGT 1 cut(s) 178
MaeIII GTNAC 1 cut(s) 96
MalI GATC 2 cut(s) 68, 124
MboI GATC 2 cut(s) 66, 122
MboII GAAGA 2 cut(s) 22, 58
MlsI TGGCCA 1 cut(s) 74
MluCI AATT 2 cut(s) 55, 292
MluNI TGGCCA 1 cut(s) 74
MmeI TCCRAC 2 cut(s) 96, 247
MnlI CCTC 2 cut(s) 105, 230
Mox20I TGGCCA 1 cut(s) 74
MscI TGGCCA 1 cut(s) 74
Msp20I TGGCCA 1 cut(s) 74
MspA1I CMGCKG 1 cut(s) 262
NdeII GATC 2 cut(s) 66, 122
NlaIII CATG 3 cut(s) 73, 157, 207
NspI RCATGY 2 cut(s) 157, 207
PaeI GCATGC 1 cut(s) 207
PciI ACATGT 1 cut(s) 153
PfeI GAWTC 1 cut(s) 232
PscI ACATGT 1 cut(s) 153
Sau3AI GATC 2 cut(s) 66, 122
SetI ASST 5 cut(s) 116, 131, 181, 222, 231
SphI GCATGC 1 cut(s) 207
Sse9I AATT 2 cut(s) 55, 292
SsiI CCGC 2 cut(s) 201, 262
TaiI ACGT 1 cut(s) 181
TasI AATT 2 cut(s) 55, 292
TfiI GAWTC 1 cut(s) 232
TscAI CASTG 1 cut(s) 283
TspDTI ATGAA 1 cut(s) 38
TspGWI ACGGA 1 cut(s) 237
TspRI CASTG 1 cut(s) 283
XceI RCATGY 2 cut(s) 157, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.