Rroxscaffold_7G00202090

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
49949127 .. 49949653
527 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00202090.1

Sequence Viewer

Length: 207 bp
ATGTCTTCTTTTAAGCGTGGGTTGAATTTTACCGTAGAAGAAGATCTACAATTGTGTCATGTATATCTTGATATTTCTCAATGTTTAATTAATGGTATTAACCAGAAAAAGGATACACTATGGGAGAGGATTGTTGTTATCTACAATGAAGGCAAGTCTCGAGGAAAGGAATCAATCTGGTGGGTCGCTTCAAAGTTGATTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.99

Weight (kDa)

7.78

Isoelectric Point (pI)

33.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 2 cut(s) 25, 192
Alw26I GTCTC 1 cut(s) 162
Ama87I CYCGRG 1 cut(s) 159
ApoI RAATTY 1 cut(s) 25
AseI ATTAAT 1 cut(s) 90
AvaI CYCGRG 1 cut(s) 159
BarI GAAGNNNNNNTAC 2 cut(s) 30, 62
BciVI GTATCC 1 cut(s) 106
BcoDI GTCTC 1 cut(s) 162
BfuI GTATCC 1 cut(s) 106
BglII AGATCT 1 cut(s) 43
BmeT110I CYCGRG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 109
BsiHKCI CYCGRG 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 109
BsmAI GTCTC 1 cut(s) 162
BsoBI CYCGRG 1 cut(s) 159
Bsp143I GATC 1 cut(s) 43
BssMI GATC 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 34
BstKTI GATC 1 cut(s) 46
BstMAI GTCTC 1 cut(s) 162
BstMBI GATC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BsuI GTATCC 1 cut(s) 106
CviAII CATG 1 cut(s) 59
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eco88I CYCGRG 1 cut(s) 159
FaeI CATG 1 cut(s) 62
FaiI YATR 3 cut(s) 60, 64, 121
FatI CATG 1 cut(s) 58
Hin1II CATG 1 cut(s) 62
HinfI GANTC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 206
Hpy188III TCNNGA 2 cut(s) 68, 159
HpyAV CCTTC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 34
Hsp92II CATG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 2 cut(s) 116, 163
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 50, 53
MfeI CAATTG 1 cut(s) 50
MflI RGATCY 1 cut(s) 43
MluCI AATT 3 cut(s) 25, 50, 87
MnlI CCTC 2 cut(s) 120, 155
MseI TTAA 4 cut(s) 12, 86, 90, 99
MunI CAATTG 1 cut(s) 50
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 62
PacI TTAATTAA 1 cut(s) 90
PaeR7I CTCGAG 1 cut(s) 159
PfeI GAWTC 1 cut(s) 170
PshBI ATTAAT 1 cut(s) 90
PsuI RGATCY 1 cut(s) 43
SaqAI TTAA 4 cut(s) 12, 86, 90, 99
Sau3AI GATC 1 cut(s) 43
Sfr274I CTCGAG 1 cut(s) 159
SgeI CNNG 8 cut(s) 29, 71, 80, 115, 166, 171, 173, 190
SlaI CTCGAG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 3 cut(s) 25, 50, 87
TaaI ACNGT 1 cut(s) 34
TaqI TCGA 1 cut(s) 160
TasI AATT 3 cut(s) 25, 50, 87
TfiI GAWTC 1 cut(s) 170
Tru1I TTAA 4 cut(s) 12, 86, 90, 99
Tru9I TTAA 4 cut(s) 12, 86, 90, 99
TspDTI ATGAA 1 cut(s) 162
VspI ATTAAT 1 cut(s) 90
XapI RAATTY 1 cut(s) 25
XhoI CTCGAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.