Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4B

Orthogroup ID

OG0001696

Physical Location & Seq

Genomic Coordinates Reverse (-)

8560660 .. 8561469

Gene Structure 810 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4BG047000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 609 bp

ATGTCTTCTTCTAAGCGTGGGTTGAATTTTACAGTAGAAGAAGATCTACAATTGTGCCATGTTTATCTTGATATTTCTCAATGTCCAATTAATGGTATTAACCAAAAAAAGGATGCACTATGGGAGAGGATTGCTGTTATCTACAATGAAGGCAAGTCTGAGGAAAGGAGTCGATCTGGTAGGTCGCTTCAAAGTCGATTTTCTGATCTATGCTTACCGGTCAGTAAACTTCATGGTCATATTCGACAAATTGAGTACCAAAATCCAAGTGGTGCATCAGAGTCCTATATTTTTCAATTTGACCATGTGTGGCCCATTCTAAAAAATGCTGAGAAATGGCTTGGTAATGCTGCCATGACTGTTCCTAAACCTTGTAGAAGGAAGGAGTCATCTGAAGGATCTCAATCAGGTTCTCGCACATCAAGGACATCTGATAGTCCATCATTTTCTATTGCTTTAAATGCAGATGAAGATGAGCAAGAGTACATCAACGATGAAGTTGCTTCACATGATCGTCCTATGGAAACGAAGATGGCAAAGATGAAAAGGAAAGCCACGATGAGAAGAAAAAGAATTATGATAAGATCATGGCCGATAACCAAGCAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM-associated

Protein Analysis

202

Amino Acids

23.21

Weight (kDa)

9.17

Isoelectric Point (pI)

76.33

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NAM-associated	PF14303	98 - 186	5.2e-09	No apical meristem-associated C-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001696)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G24380 AT1G66235 AT1G66235 AT2G13760 AT4G10230
fragaria_vesca	FvH4_1g29460 FvH4_1g29461 FvH4_2g00671 FvH4_2g02401 FvH4_4g12912 FvH4_5g16793 FvH4_5g35255 FvH4_6g21850
rosa_laevigata	RLG00000001802 RLG00000007297 RLG00000009939 RLG00000014129 RLG00000020485 RLG00000020868 RLG00000022589 RLG00000026627
rosa_multiflora	Rmu_co8293213.1_g000001 Rmu_co8323109.1_g000001 Rmu_sc0000149.1_g000032 Rmu_sc0000775.1_g000012 Rmu_sc0000776.1_g000009 Rmu_sc0001872.1_g000007 Rmu_sc0002666.1_g000024 Rmu_sc0003767.1_g000003 Rmu_sc0006410.1_g000019 Rmu_sc0006797.1_g000002 Rmu_sc0014826.1_g000002 Rmu_sc0015243.1_g000005 Rmu_sc0033419.1_g000002
rosa_roxburghii	Rroxscaffold_4G00296630 Rroxscaffold_7G00202090
rosa_samantha	Rh1BG046500 Rh2CG257500 Rh2CG423800 Rh2CG423900 Rh4BG046900 Rh4BG047000 Rh4BG078300 Rh5CG060500 Rh5CG341400 Rh6DG172800 Rh7BG334200
rosa_wichuraiana	Rw7G024310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	92
AclWI	GGATC	1 cut(s)	406
AcoI	YGGCCR	1 cut(s)	590
AcsI	RAATTY	1 cut(s)	25
AcuI	CTGAAG	1 cut(s)	414
AfaI	GTAC	2 cut(s)	257, 485
AfiI	CCNNNNNNNGG	2 cut(s)	92, 109
AgeI	ACCGGT	1 cut(s)	217
AgsI	TTSAA	3 cut(s)	25, 191, 296
AlwI	GGATC	1 cut(s)	406
AoxI	GGCC	2 cut(s)	311, 590
ApeKI	GCWGC	1 cut(s)	350
ApoI	RAATTY	1 cut(s)	25
AseI	ATTAAT	1 cut(s)	90
AsiGI	ACCGGT	1 cut(s)	217
AspS9I	GGNCC	1 cut(s)	312
BarI	GAAGNNNNNNTAC	2 cut(s)	30, 62
BbvI	GCAGC	1 cut(s)	337
BccI	CCATC	2 cut(s)	448, 526
BcgI	CGANNNNNNTGC	2 cut(s)	482, 516
BglII	AGATCT	1 cut(s)	43
BisI	GCNGC	1 cut(s)	351
BlsI	GCNGC	1 cut(s)	352
BmgT120I	GGNCC	1 cut(s)	312
BmsI	GCATC	2 cut(s)	103, 284
BsaBI	GATNNNNATC	1 cut(s)	403
BsaWI	WCCGGW	1 cut(s)	217
Bsc4I	CCNNNNNNNGG	2 cut(s)	92, 109
Bse118I	RCCGGY	1 cut(s)	217
Bse8I	GATNNNNATC	1 cut(s)	403
BseGI	GGATG	1 cut(s)	118
BseJI	GATNNNNATC	1 cut(s)	403
BseLI	CCNNNNNNNGG	2 cut(s)	92, 109
BseMII	CTCAG	2 cut(s)	150, 321
BseXI	GCAGC	1 cut(s)	337
BshFI	GGCC	2 cut(s)	313, 592
BshTI	ACCGGT	1 cut(s)	217
BsiSI	CCGG	1 cut(s)	218
BslI	CCNNNNNNNGG	2 cut(s)	92, 109
BsnI	GGCC	2 cut(s)	313, 592
Bsp143I	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
BspANI	GGCC	2 cut(s)	313, 592
BspCNI	CTCAG	2 cut(s)	151, 322
BspPI	GGATC	1 cut(s)	406
BsrFI	RCCGGY	1 cut(s)	217
BssAI	RCCGGY	1 cut(s)	217
BssMI	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
Bst4CI	ACNGT	2 cut(s)	34, 361
BstDEI	CTNAG	3 cut(s)	12, 159, 330
BstF5I	GGATG	1 cut(s)	118
BstKTI	GATC	6 cut(s)	46, 176, 208, 401, 514, 587
BstMBI	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
BstMWI	GCNNNNNNNGC	1 cut(s)	461
BstV1I	GCAGC	1 cut(s)	337
BstX2I	RGATCY	2 cut(s)	43, 398
BstYI	RGATCY	2 cut(s)	43, 398
BsuRI	GGCC	2 cut(s)	313, 592
BtsCI	GGATG	1 cut(s)	118
Cfr10I	RCCGGY	1 cut(s)	217
Cfr13I	GGNCC	1 cut(s)	312
Csp6I	GTAC	2 cut(s)	256, 484
CspAI	ACCGGT	1 cut(s)	217
CviAII	CATG	6 cut(s)	59, 233, 305, 355, 509, 588
CviJI	RGCY	4 cut(s)	313, 340, 554, 592
CviKI_1	RGCY	4 cut(s)	313, 340, 554, 592
CviQI	GTAC	2 cut(s)	256, 484
DdeI	CTNAG	3 cut(s)	12, 159, 330
DpnI	GATC	6 cut(s)	45, 175, 207, 400, 513, 586
DpnII	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
DraI	TTTAAA	1 cut(s)	459
EaeI	YGGCCR	1 cut(s)	590
Eco57I	CTGAAG	1 cut(s)	414
FaeI	CATG	6 cut(s)	62, 236, 308, 358, 512, 591
FatI	CATG	6 cut(s)	58, 232, 304, 354, 508, 587
Fnu4HI	GCNGC	1 cut(s)	351
FokI	GGATG	1 cut(s)	125
Fsp4HI	GCNGC	1 cut(s)	351
GluI	GCNGC	1 cut(s)	351
HaeIII	GGCC	2 cut(s)	313, 592
HapII	CCGG	1 cut(s)	218
Hin1II	CATG	6 cut(s)	62, 236, 308, 358, 512, 591
HinfI	GANTC	3 cut(s)	169, 281, 386
HpaII	CCGG	1 cut(s)	218
Hpy166II	GTNNAC	1 cut(s)	227
Hpy188I	TCNGA	5 cut(s)	160, 205, 280, 394, 433
Hpy188III	TCNNGA	1 cut(s)	68
Hpy8I	GTNNAC	1 cut(s)	227
HpyAV	CCTTC	4 cut(s)	143, 372, 376, 389
HpyCH4III	ACNGT	2 cut(s)	34, 361
HpyCH4V	TGCA	3 cut(s)	116, 275, 464
HpyF10VI	GCNNNNNNNGC	1 cut(s)	461
HpyF3I	CTNAG	3 cut(s)	12, 159, 330
Hsp92II	CATG	6 cut(s)	62, 236, 308, 358, 512, 591
Kzo9I	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
LpnPI	CCDG	3 cut(s)	162, 231, 393
Lsp1109I	GCAGC	1 cut(s)	337
LweI	GCATC	2 cut(s)	103, 284
MalI	GATC	6 cut(s)	45, 175, 207, 400, 513, 586
MboI	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
MboII	GAAGA	5 cut(s)	50, 53, 482, 541, 576
MfeI	CAATTG	1 cut(s)	50
MflI	RGATCY	2 cut(s)	43, 398
MluCI	AATT	6 cut(s)	25, 50, 87, 249, 296, 573
MlyI	GAGTC	3 cut(s)	178, 290, 395
MnlI	CCTC	2 cut(s)	120, 154
MseI	TTAA	3 cut(s)	90, 99, 458
MspI	CCGG	1 cut(s)	218
MunI	CAATTG	1 cut(s)	50
MwoI	GCNNNNNNNGC	1 cut(s)	461
NdeII	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
NlaIII	CATG	6 cut(s)	62, 236, 308, 358, 512, 591
PflMI	CCANNNNNTGG	1 cut(s)	92
PinAI	ACCGGT	1 cut(s)	217
PkrI	GCNGC	1 cut(s)	352
PleI	GAGTC	3 cut(s)	177, 289, 394
PpsI	GAGTC	3 cut(s)	177, 289, 394
PshBI	ATTAAT	1 cut(s)	90
PspPI	GGNCC	1 cut(s)	312
PsuI	RGATCY	2 cut(s)	43, 398
RsaI	GTAC	2 cut(s)	257, 485
RsaNI	GTAC	2 cut(s)	256, 484
SaqAI	TTAA	3 cut(s)	90, 99, 458
SatI	GCNGC	1 cut(s)	351
Sau3AI	GATC	6 cut(s)	43, 173, 205, 398, 511, 584
Sau96I	GGNCC	1 cut(s)	312
SchI	GAGTC	3 cut(s)	178, 290, 395
SetI	ASST	3 cut(s)	185, 373, 412
SfaNI	GCATC	2 cut(s)	103, 284
Sse9I	AATT	6 cut(s)	25, 50, 87, 249, 296, 573
TaaI	ACNGT	2 cut(s)	34, 361
TaqI	TCGA	3 cut(s)	172, 196, 244
TasI	AATT	6 cut(s)	25, 50, 87, 249, 296, 573
TatI	WGTACW	1 cut(s)	483
Tru1I	TTAA	3 cut(s)	90, 99, 458
Tru9I	TTAA	3 cut(s)	90, 99, 458
TseI	GCWGC	1 cut(s)	350
TspDTI	ATGAA	5 cut(s)	162, 221, 483, 510, 557
Van91I	CCANNNNNTGG	1 cut(s)	92
VspI	ATTAAT	1 cut(s)	90
XapI	RAATTY	1 cut(s)	25
XcmI	CCANNNNNNNNNTGG	1 cut(s)	266

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.