FvH4_5g03140

late blight resistance protein homolog R1B-19

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000998
Physical Location & Seq
Forward (+)
1885550 .. 1886652
1103 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g03140.t1

Sequence Viewer

Length: 420 bp
ATGAAGAAGGTGGTACTCAAACTTGATTTGCACAATGACAAGGAGAAGCAGAAGGCGTTGAAAGCAGTGTCTAGCCTTTCTGGCATTGATTCCATCGCTATGGACATGAAAGAGAGGAAGTTAACTGTGACTGGCAATATCGATCCGGTTGATGTGGTGAACAAGTTGCGGAAAGGTAACTGGCACACTGAGATTTTGACAGTTGGGCCAGCCAAAGAAGAGAAGAAAGATGATAAGAAAGATGGAGGAGCTAATAAGAAAGATGATGATAAGAAGAAGGAAGATGAAAAGAAGAAGCAGGACCCTAATCAACAAATTGCTGAACTTGTGCGAGCCTATCAAAACTATAATCCACATATGACGAAGTACTACTATGTGCAGAGCGCAGAAGAAAACCCAAATGCATGTGTTATTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

140

Amino Acids

15.83

Weight (kDa)

8.96

Isoelectric Point (pI)

37.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 10 - 58 2.8e-08 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 137
AfaI GTAC 2 cut(s) 15, 368
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 1 cut(s) 251
AluI AGCT 1 cut(s) 251
AlwI GGATC 1 cut(s) 137
AoxI GGCC 1 cut(s) 206
AspLEI GCGC 1 cut(s) 386
AspS9I GGNCC 2 cut(s) 206, 301
AsuHPI GGTGA 1 cut(s) 169
AvaII GGWCC 1 cut(s) 301
BccI CCATC 2 cut(s) 101, 236
BfaI CTAG 1 cut(s) 72
BglI GCCNNNNNGGC 1 cut(s) 81
BmcAI AGTACT 1 cut(s) 368
Bme18I GGWCC 1 cut(s) 301
BmgT120I GGNCC 2 cut(s) 206, 301
BmiI GGNNCC 1 cut(s) 303
Bsa29I ATCGAT 1 cut(s) 141
BsaWI WCCGGW 1 cut(s) 145
Bse1I ACTGG 2 cut(s) 136, 185
BseCI ATCGAT 1 cut(s) 141
BseMII CTCAG 1 cut(s) 180
BseNI ACTGG 2 cut(s) 136, 185
BseRI GAGGAG 1 cut(s) 261
BsgI GTGCAG 1 cut(s) 398
BshFI GGCC 1 cut(s) 208
BshVI ATCGAT 1 cut(s) 141
BsiSI CCGG 1 cut(s) 146
BsnI GGCC 1 cut(s) 208
Bsp143I GATC 1 cut(s) 142
BspACI CCGC 1 cut(s) 169
BspANI GGCC 1 cut(s) 208
BspCNI CTCAG 1 cut(s) 181
BspDI ATCGAT 1 cut(s) 141
BspLI GGNNCC 1 cut(s) 303
BspPI GGATC 1 cut(s) 137
BsrI ACTGG 2 cut(s) 136, 185
BssMI GATC 1 cut(s) 142
Bst4CI ACNGT 2 cut(s) 127, 202
Bst6I CTCTTC 1 cut(s) 213
BstC8I GCNNGC 2 cut(s) 210, 333
BstDEI CTNAG 1 cut(s) 189
BstHHI GCGC 1 cut(s) 386
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstMWI GCNNNNNNNGC 2 cut(s) 62, 81
BstNSI RCATGY 1 cut(s) 408
BstXI CCANNNNNNTGG 1 cut(s) 100
Bsu15I ATCGAT 1 cut(s) 141
BsuRI GGCC 1 cut(s) 208
BsuTUI ATCGAT 1 cut(s) 141
BtgZI GCGATG 1 cut(s) 79
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 2 cut(s) 72, 186
Cac8I GCNNGC 2 cut(s) 210, 333
CfoI GCGC 1 cut(s) 386
Cfr13I GGNCC 2 cut(s) 206, 301
ClaI ATCGAT 1 cut(s) 141
Csp6I GTAC 2 cut(s) 14, 367
CviAII CATG 2 cut(s) 106, 405
CviJI RGCY 5 cut(s) 75, 208, 212, 251, 335
CviKI_1 RGCY 5 cut(s) 75, 208, 212, 251, 335
CviQI GTAC 2 cut(s) 14, 367
DdeI CTNAG 1 cut(s) 189
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 301
EcoO109I RGGNCCY 1 cut(s) 301
EcoT22I ATGCAT 1 cut(s) 406
FaeI CATG 2 cut(s) 109, 408
FaiI YATR 7 cut(s) 101, 107, 348, 357, 359, 375, 406
FatI CATG 2 cut(s) 105, 404
FauNDI CATATG 1 cut(s) 357
FspBI CTAG 1 cut(s) 72
GlaI GCGC 1 cut(s) 385
HaeIII GGCC 1 cut(s) 208
HapII CCGG 1 cut(s) 146
HhaI GCGC 1 cut(s) 386
Hin1II CATG 2 cut(s) 109, 408
Hin6I GCGC 1 cut(s) 384
HinP1I GCGC 1 cut(s) 384
HincII GTYRAC 1 cut(s) 123
HindII GTYRAC 1 cut(s) 123
HinfI GANTC 1 cut(s) 89
HpaI GTTAAC 1 cut(s) 123
HpaII CCGG 1 cut(s) 146
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 2 cut(s) 123, 160
Hpy8I GTNNAC 2 cut(s) 123, 160
HpyAV CCTTC 2 cut(s) 46, 271
HpyCH4III ACNGT 2 cut(s) 127, 202
HpyCH4V TGCA 3 cut(s) 31, 379, 404
HpyF10VI GCNNNNNNNGC 2 cut(s) 62, 81
HpyF3I CTNAG 1 cut(s) 189
Hsp92II CATG 2 cut(s) 109, 408
HspAI GCGC 1 cut(s) 384
KspAI GTTAAC 1 cut(s) 123
Kzo9I GATC 1 cut(s) 142
LmnI GCTCC 1 cut(s) 248
LpnPI CCDG 6 cut(s) 66, 117, 159, 166, 222, 284
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 2 cut(s) 127, 176
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 7 cut(s) 16, 230, 235, 286, 293, 304, 401
MluCI AATT 1 cut(s) 315
MnlI CCTC 2 cut(s) 108, 239
Mph1103I ATGCAT 1 cut(s) 406
MseI TTAA 2 cut(s) 122, 418
MslI CAYNNNNRTG 1 cut(s) 98
MspI CCGG 1 cut(s) 146
MwoI GCNNNNNNNGC 2 cut(s) 62, 81
NdeI CATATG 1 cut(s) 357
NdeII GATC 1 cut(s) 142
NlaIII CATG 2 cut(s) 109, 408
NlaIV GGNNCC 1 cut(s) 303
NmuCI GTSAC 1 cut(s) 127
NsiI ATGCAT 1 cut(s) 406
NspI RCATGY 1 cut(s) 408
PfeI GAWTC 1 cut(s) 89
PpuMI RGGWCCY 1 cut(s) 301
Psp5II RGGWCCY 1 cut(s) 301
PspN4I GGNNCC 1 cut(s) 303
PspPI GGNCC 2 cut(s) 206, 301
PspPPI RGGWCCY 1 cut(s) 301
RsaI GTAC 2 cut(s) 15, 368
RsaNI GTAC 2 cut(s) 14, 367
RseI CAYNNNNRTG 1 cut(s) 98
SaqAI TTAA 2 cut(s) 122, 418
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 2 cut(s) 206, 301
ScaI AGTACT 1 cut(s) 368
SetI ASST 3 cut(s) 12, 178, 253
SinI GGWCC 1 cut(s) 301
SmiMI CAYNNNNRTG 1 cut(s) 98
Sse9I AATT 1 cut(s) 315
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 72
TaaI ACNGT 2 cut(s) 127, 202
TaqI TCGA 1 cut(s) 141
TasI AATT 1 cut(s) 315
TatI WGTACW 1 cut(s) 366
TfiI GAWTC 1 cut(s) 89
Tru1I TTAA 2 cut(s) 122, 418
Tru9I TTAA 2 cut(s) 122, 418
TscAI CASTG 2 cut(s) 72, 193
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspDTI ATGAA 3 cut(s) 17, 122, 300
TspRI CASTG 2 cut(s) 72, 193
VpaK11BI GGWCC 1 cut(s) 301
XceI RCATGY 1 cut(s) 408
XspI CTAG 1 cut(s) 72
ZrmI AGTACT 1 cut(s) 368
Zsp2I ATGCAT 1 cut(s) 406
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.