Rh1BG238000

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
36153957 .. 36156389
2433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG238000.1

Sequence Viewer

Length: 549 bp
ATGTTCTTGCAGAAGGTTATTCTGAGATTGGATTTGCATGATGACAAAGCCAAGCAGAAGGCATTGAAGACAGTCTCTACTCTTTCAGGCATTGATTCCATCGCCATGGACATGAAGGAGAAGAAACTAACAGTGATCGGGTCGGTGGATCCAGTGAATGTGGTGAGCAAATTGCGCAAGTATTGGCCAACAGATATGATCTCAGTAGGGCCAGCAGTAGAGCCTAAGAAAGAGGAGCCAAAGAAGGAAGAAGCAAAGAAAGAAGAAGGAAAGAAGGAAGGAGAGGAAGCGAAGAAAGAAGGGGAAGAGGCGAAGAAGGAGGAACCCAAGAAAGAGGAGGAGAAGAAAGAAGGAGGAGGAGAGGAAGCTAAGAAAGAAGAGCCAAAGAAAGAGGAAGAGAAGAAAGAAGAAGAGAAGAAGAAAGAGGTTCCTCCTCCAGACCCCGTCTTAGAGCTTGTCAAGGCTTACAGAGCATACAACCCTCACATGACCACTTATTACTATGTGCAAAGCATGGAAGAGAATCCAAATGCTTGTGTTATTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

182

Amino Acids

20.8

Weight (kDa)

5.75

Isoelectric Point (pI)

53.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 11 - 60 6.2e-08 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 176
AclWI GGATC 2 cut(s) 143, 156
AcoI YGGCCR 1 cut(s) 185
AgsI TTSAA 1 cut(s) 67
AluBI AGCT 2 cut(s) 368, 454
AluI AGCT 2 cut(s) 368, 454
Alw26I GTCTC 1 cut(s) 79
AlwI GGATC 2 cut(s) 143, 156
AoxI GGCC 2 cut(s) 185, 209
AspLEI GCGC 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 209
AsuHPI GGTGA 1 cut(s) 175
BalI TGGCCA 1 cut(s) 187
BamHI GGATCC 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 74
BccI CCATC 1 cut(s) 107
BcoDI GTCTC 1 cut(s) 79
BmgT120I GGNCC 1 cut(s) 209
BmiI GGNNCC 4 cut(s) 150, 237, 324, 429
BpiI GAAGAC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 420
BsaJI CCNNGG 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 152
BseDI CCNNGG 1 cut(s) 105
BseMII CTCAG 2 cut(s) 14, 216
BseNI ACTGG 1 cut(s) 152
BseRI GAGGAG 6 cut(s) 248, 350, 353, 369, 372, 423
BshFI GGCC 2 cut(s) 187, 211
BsmAI GTCTC 1 cut(s) 79
BsnI GGCC 2 cut(s) 187, 211
Bsp143I GATC 3 cut(s) 135, 148, 198
Bsp19I CCATGG 1 cut(s) 105
BspANI GGCC 2 cut(s) 187, 211
BspCNI CTCAG 2 cut(s) 15, 215
BspLI GGNNCC 4 cut(s) 150, 237, 324, 429
BspPI GGATC 2 cut(s) 143, 156
BspQI GCTCTTC 1 cut(s) 372
BsrI ACTGG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 105
BssMI GATC 3 cut(s) 135, 148, 198
BssT1I CCWWGG 1 cut(s) 105
Bst4CI ACNGT 2 cut(s) 73, 133
Bst6I CTCTTC 5 cut(s) 300, 372, 390, 405, 513
BstC8I GCNNGC 1 cut(s) 213
BstDEI CTNAG 5 cut(s) 23, 202, 225, 369, 448
BstDSI CCRYGG 1 cut(s) 105
BstHHI GCGC 1 cut(s) 177
BstKTI GATC 3 cut(s) 138, 151, 201
BstMAI GTCTC 1 cut(s) 79
BstMBI GATC 3 cut(s) 135, 148, 198
BstMWI GCNNNNNNNGC 2 cut(s) 174, 470
BstV2I GAAGAC 1 cut(s) 74
BstX2I RGATCY 1 cut(s) 148
BstXI CCANNNNNNTGG 1 cut(s) 106
BstYI RGATCY 1 cut(s) 148
BsuRI GGCC 2 cut(s) 187, 211
BtgI CCRYGG 1 cut(s) 105
BtgZI GCGATG 1 cut(s) 85
BtsIMutI CAGTG 2 cut(s) 138, 159
Cac8I GCNNGC 1 cut(s) 213
CfoI GCGC 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 209
CviAII CATG 5 cut(s) 38, 106, 112, 487, 514
CviJI RGCY 9 cut(s) 50, 187, 211, 223, 238, 368, 382, 454, 464
CviKI_1 RGCY 9 cut(s) 50, 187, 211, 223, 238, 368, 382, 454, 464
DdeI CTNAG 5 cut(s) 23, 202, 225, 369, 448
DpnI GATC 3 cut(s) 137, 150, 200
DpnII GATC 3 cut(s) 135, 148, 198
EaeI YGGCCR 1 cut(s) 185
Eam1104I CTCTTC 5 cut(s) 300, 372, 390, 405, 513
EarI CTCTTC 5 cut(s) 300, 372, 390, 405, 513
Eco130I CCWWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 105
ErhI CCWWGG 1 cut(s) 105
FaeI CATG 5 cut(s) 41, 109, 115, 490, 517
FaiI YATR 8 cut(s) 39, 107, 113, 197, 475, 488, 504, 515
FatI CATG 5 cut(s) 37, 105, 111, 486, 513
FspI TGCGCA 1 cut(s) 176
GlaI GCGC 1 cut(s) 176
GsuI CTGGAG 1 cut(s) 420
HaeIII GGCC 2 cut(s) 187, 211
HhaI GCGC 1 cut(s) 177
Hin1II CATG 5 cut(s) 41, 109, 115, 490, 517
Hin6I GCGC 1 cut(s) 175
HinP1I GCGC 1 cut(s) 175
HinfI GANTC 2 cut(s) 95, 523
HphI GGTGA 1 cut(s) 175
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 437
HpyCH4III ACNGT 2 cut(s) 73, 133
HpyCH4V TGCA 3 cut(s) 10, 37, 508
HpyF10VI GCNNNNNNNGC 2 cut(s) 174, 470
HpyF3I CTNAG 5 cut(s) 23, 202, 225, 369, 448
Hsp92II CATG 5 cut(s) 41, 109, 115, 490, 517
HspAI GCGC 1 cut(s) 175
Kzo9I GATC 3 cut(s) 135, 148, 198
LguI GCTCTTC 1 cut(s) 372
LmnI GCTCC 1 cut(s) 235
LpnPI CCDG 4 cut(s) 72, 165, 225, 450
MalI GATC 3 cut(s) 137, 150, 200
MboI GATC 3 cut(s) 135, 148, 198
MflI RGATCY 1 cut(s) 148
MlsI TGGCCA 1 cut(s) 187
MluCI AATT 1 cut(s) 170
MluNI TGGCCA 1 cut(s) 187
Mox20I TGGCCA 1 cut(s) 187
MscI TGGCCA 1 cut(s) 187
MslI CAYNNNNRTG 2 cut(s) 104, 110
Msp20I TGGCCA 1 cut(s) 187
MwoI GCNNNNNNNGC 2 cut(s) 174, 470
NcoI CCATGG 1 cut(s) 105
NdeII GATC 3 cut(s) 135, 148, 198
NlaIII CATG 5 cut(s) 41, 109, 115, 490, 517
NlaIV GGNNCC 4 cut(s) 150, 237, 324, 429
NsbI TGCGCA 1 cut(s) 176
PciSI GCTCTTC 1 cut(s) 372
PfeI GAWTC 2 cut(s) 95, 523
PflFI GACNNNGTC 1 cut(s) 443
PspN4I GGNNCC 4 cut(s) 150, 237, 324, 429
PspPI GGNCC 1 cut(s) 209
PsuI RGATCY 1 cut(s) 148
PsyI GACNNNGTC 1 cut(s) 443
RseI CAYNNNNRTG 2 cut(s) 104, 110
SapI GCTCTTC 1 cut(s) 372
Sau3AI GATC 3 cut(s) 135, 148, 198
Sau96I GGNCC 1 cut(s) 209
SetI ASST 4 cut(s) 18, 370, 429, 456
SmiMI CAYNNNNRTG 2 cut(s) 104, 110
Sse9I AATT 1 cut(s) 170
StyI CCWWGG 1 cut(s) 105
TaaI ACNGT 2 cut(s) 73, 133
TasI AATT 1 cut(s) 170
TfiI GAWTC 2 cut(s) 95, 523
TscAI CASTG 2 cut(s) 138, 159
TspDTI ATGAA 1 cut(s) 128
TspRI CASTG 2 cut(s) 138, 159
Tth111I GACNNNGTC 1 cut(s) 443
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.