Rh1DG266100

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
48318068 .. 48320500
2433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG266100.1

Sequence Viewer

Length: 444 bp
ATGGACATGAAGGAGAAGAAACTAACAGTGATCGGGTCGGTGGATCCAGTGAATGTGGTGAGCAAATTGCGCAAGTATTGGCCAACAGATATGATCTCAGTAGGGCCAGCAGTAGAGCCTAAGAAAGAGGAGCCAAAGAAGGAAGAAGCAAAGAAAGAAGAAGGAAAGAAGGAAGGAGAGGAAGCGAAGAAAGAAGGGGAAGAGGCGAAGAAGGAGGAACCCAAGAAAGAGGAGGAGAAGAAAGAAGGAGGAGGAGAGGAAGCTAAGAAAGAAGAGCCAAAGAAAGAGGAAGAGAAGAAAGAAGAAGAGAAGAAGAAAGAGGTTCCTCCTCCAGACCCCGTCTTAGAGCTTGTCAAGGCTTACAGAGCATACAACCCTCACATGACCACTTATTACTATGTGCAAAGCATGGAAGAGAATCCAAATGCTTGTGTTATTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

16.93

Weight (kDa)

5.33

Isoelectric Point (pI)

58.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 71
AclWI GGATC 2 cut(s) 38, 51
AcoI YGGCCR 1 cut(s) 80
AluBI AGCT 2 cut(s) 263, 349
AluI AGCT 2 cut(s) 263, 349
AlwI GGATC 2 cut(s) 38, 51
AoxI GGCC 2 cut(s) 80, 104
AspLEI GCGC 1 cut(s) 72
AspS9I GGNCC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 70
BalI TGGCCA 1 cut(s) 82
BamHI GGATCC 1 cut(s) 43
BmgT120I GGNCC 1 cut(s) 104
BmiI GGNNCC 4 cut(s) 45, 132, 219, 324
BpmI CTGGAG 1 cut(s) 315
Bse1I ACTGG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 111
BseNI ACTGG 1 cut(s) 47
BseRI GAGGAG 6 cut(s) 143, 245, 248, 264, 267, 318
BshFI GGCC 2 cut(s) 82, 106
BsnI GGCC 2 cut(s) 82, 106
Bsp143I GATC 3 cut(s) 30, 43, 93
BspANI GGCC 2 cut(s) 82, 106
BspCNI CTCAG 1 cut(s) 110
BspLI GGNNCC 4 cut(s) 45, 132, 219, 324
BspPI GGATC 2 cut(s) 38, 51
BspQI GCTCTTC 1 cut(s) 267
BsrI ACTGG 1 cut(s) 47
BssMI GATC 3 cut(s) 30, 43, 93
Bst4CI ACNGT 1 cut(s) 28
Bst6I CTCTTC 5 cut(s) 195, 267, 285, 300, 408
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 4 cut(s) 97, 120, 264, 343
BstHHI GCGC 1 cut(s) 72
BstKTI GATC 3 cut(s) 33, 46, 96
BstMBI GATC 3 cut(s) 30, 43, 93
BstMWI GCNNNNNNNGC 2 cut(s) 69, 365
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BsuRI GGCC 2 cut(s) 82, 106
BtsIMutI CAGTG 2 cut(s) 33, 54
Cac8I GCNNGC 1 cut(s) 108
CfoI GCGC 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 104
CviAII CATG 3 cut(s) 7, 382, 409
CviJI RGCY 8 cut(s) 82, 106, 118, 133, 263, 277, 349, 359
CviKI_1 RGCY 8 cut(s) 82, 106, 118, 133, 263, 277, 349, 359
DdeI CTNAG 4 cut(s) 97, 120, 264, 343
DpnI GATC 3 cut(s) 32, 45, 95
DpnII GATC 3 cut(s) 30, 43, 93
EaeI YGGCCR 1 cut(s) 80
Eam1104I CTCTTC 5 cut(s) 195, 267, 285, 300, 408
EarI CTCTTC 5 cut(s) 195, 267, 285, 300, 408
FaeI CATG 3 cut(s) 10, 385, 412
FaiI YATR 6 cut(s) 8, 92, 370, 383, 399, 410
FatI CATG 3 cut(s) 6, 381, 408
FspI TGCGCA 1 cut(s) 71
GlaI GCGC 1 cut(s) 71
GsuI CTGGAG 1 cut(s) 315
HaeIII GGCC 2 cut(s) 82, 106
HhaI GCGC 1 cut(s) 72
Hin1II CATG 3 cut(s) 10, 385, 412
Hin6I GCGC 1 cut(s) 70
HinP1I GCGC 1 cut(s) 70
HinfI GANTC 1 cut(s) 418
HphI GGTGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 332
HpyAV CCTTC 8 cut(s) 4, 133, 155, 163, 167, 188, 205, 239
HpyCH4III ACNGT 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 403
HpyF10VI GCNNNNNNNGC 2 cut(s) 69, 365
HpyF3I CTNAG 4 cut(s) 97, 120, 264, 343
Hsp92II CATG 3 cut(s) 10, 385, 412
HspAI GCGC 1 cut(s) 70
Kzo9I GATC 3 cut(s) 30, 43, 93
LguI GCTCTTC 1 cut(s) 267
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 60, 120, 345
MalI GATC 3 cut(s) 32, 45, 95
MboI GATC 3 cut(s) 30, 43, 93
MflI RGATCY 1 cut(s) 43
MlsI TGGCCA 1 cut(s) 82
MluCI AATT 1 cut(s) 65
MluNI TGGCCA 1 cut(s) 82
Mox20I TGGCCA 1 cut(s) 82
MscI TGGCCA 1 cut(s) 82
Msp20I TGGCCA 1 cut(s) 82
MwoI GCNNNNNNNGC 2 cut(s) 69, 365
NdeII GATC 3 cut(s) 30, 43, 93
NlaIII CATG 3 cut(s) 10, 385, 412
NlaIV GGNNCC 4 cut(s) 45, 132, 219, 324
NsbI TGCGCA 1 cut(s) 71
PciSI GCTCTTC 1 cut(s) 267
PfeI GAWTC 1 cut(s) 418
PflFI GACNNNGTC 1 cut(s) 338
PspN4I GGNNCC 4 cut(s) 45, 132, 219, 324
PspPI GGNCC 1 cut(s) 104
PsuI RGATCY 1 cut(s) 43
PsyI GACNNNGTC 1 cut(s) 338
SapI GCTCTTC 1 cut(s) 267
Sau3AI GATC 3 cut(s) 30, 43, 93
Sau96I GGNCC 1 cut(s) 104
SetI ASST 3 cut(s) 265, 324, 351
Sse9I AATT 1 cut(s) 65
TaaI ACNGT 1 cut(s) 28
TasI AATT 1 cut(s) 65
TfiI GAWTC 1 cut(s) 418
TscAI CASTG 2 cut(s) 33, 54
TspDTI ATGAA 1 cut(s) 23
TspRI CASTG 2 cut(s) 33, 54
Tth111I GACNNNGTC 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.