Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr1

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

10350595 .. 10350998

Gene Structure 404 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom01g09470.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

ATGGTATCGTTTGGTATGCAGACAGGACGGGACGGAACGGGACAGGACGGGACGGAACGGAGCGGGAGCAAAGATGCCCTCAGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCACCCAAAACTCGTCCCATGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACGCCTTGTTCCACTCTGTTCCGTCCCGTCCCACGTACCAAACGGTACCTAAGCGATTAAAACGTAATAGTATTCACTCATGCACTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

113

Amino Acids

12.61

Weight (kDa)

11.75

Isoelectric Point (pI)

92.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	123
Acc65I	GGTACC	1 cut(s)	295
AccB1I	GGYRCC	1 cut(s)	295
AccBSI	CCGCTC	1 cut(s)	63
AciI	CCGC	1 cut(s)	63
AcsI	RAATTY	1 cut(s)	181
AfaI	GTAC	2 cut(s)	287, 297
AfiI	CCNNNNNNNGG	3 cut(s)	84, 227, 242
AjnI	CCWGG	1 cut(s)	158
AleI	CACNNNNGTG	1 cut(s)	141
AluBI	AGCT	1 cut(s)	211
AluI	AGCT	1 cut(s)	211
Alw26I	GTCTC	1 cut(s)	103
ApoI	RAATTY	1 cut(s)	181
Asp718I	GGTACC	1 cut(s)	295
AspLEI	GCGC	1 cut(s)	233
AsuHPI	GGTGA	2 cut(s)	177, 178
BanI	GGYRCC	1 cut(s)	295
BccI	CCATC	1 cut(s)	78
BciT130I	CCWGG	1 cut(s)	160
BcoDI	GTCTC	1 cut(s)	103
Bme1390I	CCNGG	1 cut(s)	160
BmiI	GGNNCC	1 cut(s)	297
BmrFI	CCNGG	1 cut(s)	160
BmsI	GCATC	1 cut(s)	64
Bpu10I	CCTNAGC	1 cut(s)	300
BsaAI	YACGTR	1 cut(s)	285
BsaJI	CCNNGG	3 cut(s)	136, 159, 201
Bsc4I	CCNNNNNNNGG	3 cut(s)	84, 227, 242
BseBI	CCWGG	1 cut(s)	160
BseDI	CCNNGG	3 cut(s)	136, 159, 201
BseGI	GGATG	1 cut(s)	146
BseLI	CCNNNNNNNGG	3 cut(s)	84, 227, 242
BseMII	CTCAG	1 cut(s)	94
BshNI	GGYRCC	1 cut(s)	295
BslFI	GGGAC	7 cut(s)	44, 54, 64, 183, 258, 259, 264
BslI	CCNNNNNNNGG	3 cut(s)	84, 227, 242
BsmAI	GTCTC	1 cut(s)	103
BsmBI	CGTCTC	1 cut(s)	103
BsmFI	GGGAC	7 cut(s)	44, 54, 64, 183, 258, 259, 264
Bsp19I	CCATGG	1 cut(s)	201
BspACI	CCGC	1 cut(s)	63
BspCNI	CTCAG	1 cut(s)	93
BspLI	GGNNCC	1 cut(s)	297
BspT107I	GGYRCC	1 cut(s)	295
BsrBI	CCGCTC	1 cut(s)	63
BssECI	CCNNGG	3 cut(s)	136, 159, 201
BssT1I	CCWWGG	1 cut(s)	201
Bst2UI	CCWGG	1 cut(s)	160
Bst4CI	ACNGT	1 cut(s)	295
BstBAI	YACGTR	1 cut(s)	285
BstDEI	CTNAG	2 cut(s)	80, 300
BstDSI	CCRYGG	2 cut(s)	136, 201
BstF5I	GGATG	1 cut(s)	146
BstHHI	GCGC	1 cut(s)	233
BstMAI	GTCTC	1 cut(s)	103
BstNI	CCWGG	1 cut(s)	160
BstSCI	CCNGG	1 cut(s)	158
BstXI	CCANNNNNNTGG	1 cut(s)	143
BtgI	CCRYGG	2 cut(s)	136, 201
BtsCI	GGATG	1 cut(s)	146
CfoI	GCGC	1 cut(s)	233
Csp6I	GTAC	2 cut(s)	286, 296
CviAII	CATG	2 cut(s)	202, 330
CviJI	RGCY	1 cut(s)	211
CviKI_1	RGCY	1 cut(s)	211
CviQI	GTAC	2 cut(s)	286, 296
DdeI	CTNAG	2 cut(s)	80, 300
Eco130I	CCWWGG	1 cut(s)	201
EcoRII	CCWGG	1 cut(s)	158
EcoT14I	CCWWGG	1 cut(s)	201
ErhI	CCWWGG	1 cut(s)	201
Esp3I	CGTCTC	1 cut(s)	103
FaeI	CATG	2 cut(s)	205, 333
FaiI	YATR	4 cut(s)	17, 123, 203, 331
FaqI	GGGAC	7 cut(s)	44, 54, 64, 183, 258, 259, 264
FatI	CATG	2 cut(s)	201, 329
FauI	CCCGC	1 cut(s)	56
FokI	GGATG	1 cut(s)	153
GlaI	GCGC	1 cut(s)	232
HhaI	GCGC	1 cut(s)	233
Hin1II	CATG	2 cut(s)	205, 333
Hin6I	GCGC	1 cut(s)	231
HinP1I	GCGC	1 cut(s)	231
HinfI	GANTC	1 cut(s)	151
HphI	GGTGA	2 cut(s)	177, 178
Hpy188I	TCNGA	1 cut(s)	83
HpyAV	CCTTC	1 cut(s)	99
HpyCH4III	ACNGT	1 cut(s)	295
HpyCH4IV	ACGT	3 cut(s)	240, 284, 313
HpyCH4V	TGCA	2 cut(s)	19, 333
HpyF3I	CTNAG	2 cut(s)	80, 300
HpySE526I	ACGT	3 cut(s)	240, 284, 313
Hsp92II	CATG	2 cut(s)	205, 333
HspAI	GCGC	1 cut(s)	231
KpnI	GGTACC	1 cut(s)	299
LmnI	GCTCC	2 cut(s)	60, 66
LpnPI	CCDG	4 cut(s)	9, 29, 145, 172
LweI	GCATC	1 cut(s)	64
MaeII	ACGT	3 cut(s)	240, 284, 313
MbiI	CCGCTC	1 cut(s)	63
MboII	GAAGA	2 cut(s)	111, 114
MluCI	AATT	2 cut(s)	124, 181
MlyI	GAGTC	1 cut(s)	160
MnlI	CCTC	4 cut(s)	89, 89, 110, 162
MseI	TTAA	2 cut(s)	308, 337
MslI	CAYNNNNRTG	1 cut(s)	141
MspR9I	CCNGG	1 cut(s)	160
MvaI	CCWGG	1 cut(s)	160
NcoI	CCATGG	1 cut(s)	201
NlaIII	CATG	2 cut(s)	205, 333
NlaIV	GGNNCC	1 cut(s)	297
OliI	CACNNNNGTG	1 cut(s)	141
PcsI	WCGNNNNNNNCGW	1 cut(s)	219
PleI	GAGTC	1 cut(s)	159
PpsI	GAGTC	1 cut(s)	159
Ppu21I	YACGTR	1 cut(s)	285
PsiI	TTATAA	1 cut(s)	123
Psp6I	CCWGG	1 cut(s)	158
PspGI	CCWGG	1 cut(s)	158
PspN4I	GGNNCC	1 cut(s)	297
RsaI	GTAC	2 cut(s)	287, 297
RsaNI	GTAC	2 cut(s)	286, 296
RseI	CAYNNNNRTG	1 cut(s)	141
SaqAI	TTAA	2 cut(s)	308, 337
SchI	GAGTC	1 cut(s)	160
ScrFI	CCNGG	1 cut(s)	160
SetI	ASST	7 cut(s)	121, 173, 213, 243, 287, 301, 316
SfaNI	GCATC	1 cut(s)	64
SmiMI	CAYNNNNRTG	1 cut(s)	141
Sse9I	AATT	2 cut(s)	124, 181
SsiI	CCGC	1 cut(s)	63
StyD4I	CCNGG	1 cut(s)	158
StyI	CCWWGG	1 cut(s)	201
TaaI	ACNGT	1 cut(s)	295
TaiI	ACGT	3 cut(s)	243, 287, 316
TasI	AATT	2 cut(s)	124, 181
Tru1I	TTAA	2 cut(s)	308, 337
Tru9I	TTAA	2 cut(s)	308, 337
TspGWI	ACGGA	7 cut(s)	48, 68, 73, 127, 153, 261, 262
XapI	RAATTY	1 cut(s)	181

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.