Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr2

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

20364422 .. 20365201

Gene Structure 780 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom02g22210.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

ATGTATTTGGACGAAATTGAATCAAAGAGGAAGTTGGAGGTATCGTTTGGTATGCAGACGGGACAGGACGGAACGGAACGAGACGGGACGGAACGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGTAGAAGATGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAATGAAAATTCACTCAAAACTCGTCCCGTGGAACAACTCGTTCCACCCGTTTTAGGCGCACCAGACGTGGGACGGAACACCTTGTCCCACTCTATTCCGTCCCGTCCCATGTACCAAACGGTACCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

113

Amino Acids

12.69

Weight (kDa)

10.19

Isoelectric Point (pI)

78.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	159
Acc65I	GGTACC	1 cut(s)	331
AccB1I	GGYRCC	1 cut(s)	331
AccBSI	CCGCTC	1 cut(s)	99
AciI	CCGC	1 cut(s)	99
AcsI	RAATTY	1 cut(s)	217
AfaI	GTAC	2 cut(s)	323, 333
AfiI	CCNNNNNNNGG	3 cut(s)	120, 263, 278
AgsI	TTSAA	1 cut(s)	20
AjiI	CACGTC	1 cut(s)	277
AjnI	CCWGG	1 cut(s)	194
AleI	CACNNNNGTG	1 cut(s)	177
AloI	GAACNNNNNNTCC	2 cut(s)	278, 310
Alw26I	GTCTC	2 cut(s)	75, 139
ApoI	RAATTY	1 cut(s)	217
Asp718I	GGTACC	1 cut(s)	331
AspLEI	GCGC	1 cut(s)	269
AsuHPI	GGTGA	1 cut(s)	214
BanI	GGYRCC	1 cut(s)	331
BccI	CCATC	2 cut(s)	114, 135
BciT130I	CCWGG	1 cut(s)	196
BcoDI	GTCTC	2 cut(s)	75, 139
Bme1390I	CCNGG	1 cut(s)	196
BmgBI	CACGTC	1 cut(s)	277
BmiI	GGNNCC	1 cut(s)	333
BmrFI	CCNGG	1 cut(s)	196
BmsI	GCATC	1 cut(s)	100
BsaJI	CCNNGG	4 cut(s)	115, 172, 195, 237
BsaXI	ACNNNNNCTCC	2 cut(s)	29, 59
Bsc4I	CCNNNNNNNGG	3 cut(s)	120, 263, 278
BseBI	CCWGG	1 cut(s)	196
BseDI	CCNNGG	4 cut(s)	115, 172, 195, 237
BseGI	GGATG	2 cut(s)	125, 182
BseLI	CCNNNNNNNGG	3 cut(s)	120, 263, 278
BshNI	GGYRCC	1 cut(s)	331
BslFI	GGGAC	7 cut(s)	75, 100, 219, 280, 294, 295, 300
BslI	CCNNNNNNNGG	3 cut(s)	120, 263, 278
BsmAI	GTCTC	2 cut(s)	75, 139
BsmBI	CGTCTC	2 cut(s)	75, 139
BsmFI	GGGAC	7 cut(s)	75, 100, 219, 280, 294, 295, 300
BspACI	CCGC	1 cut(s)	99
BspLI	GGNNCC	1 cut(s)	333
BspT107I	GGYRCC	1 cut(s)	331
BsrBI	CCGCTC	1 cut(s)	99
BssECI	CCNNGG	4 cut(s)	115, 172, 195, 237
Bst2UI	CCWGG	1 cut(s)	196
Bst4CI	ACNGT	1 cut(s)	331
BstDSI	CCRYGG	2 cut(s)	172, 237
BstF5I	GGATG	2 cut(s)	125, 182
BstHHI	GCGC	1 cut(s)	269
BstMAI	GTCTC	2 cut(s)	75, 139
BstNI	CCWGG	1 cut(s)	196
BstSCI	CCNGG	1 cut(s)	194
BstXI	CCANNNNNNTGG	1 cut(s)	179
BtgI	CCRYGG	2 cut(s)	172, 237
BtrI	CACGTC	1 cut(s)	277
BtsCI	GGATG	2 cut(s)	125, 182
CfoI	GCGC	1 cut(s)	269
Csp6I	GTAC	2 cut(s)	322, 332
CviAII	CATG	1 cut(s)	319
CviQI	GTAC	2 cut(s)	322, 332
EcoRII	CCWGG	1 cut(s)	194
Esp3I	CGTCTC	2 cut(s)	75, 139
FaeI	CATG	1 cut(s)	322
FaiI	YATR	4 cut(s)	53, 159, 320, 337
FaqI	GGGAC	7 cut(s)	75, 100, 219, 280, 294, 295, 300
FatI	CATG	1 cut(s)	318
FauI	CCCGC	1 cut(s)	92
FokI	GGATG	2 cut(s)	132, 189
GlaI	GCGC	1 cut(s)	268
HhaI	GCGC	1 cut(s)	269
Hin1II	CATG	1 cut(s)	322
Hin6I	GCGC	1 cut(s)	267
HinP1I	GCGC	1 cut(s)	267
HinfI	GANTC	2 cut(s)	20, 187
HphI	GGTGA	1 cut(s)	214
Hpy188I	TCNGA	1 cut(s)	119
HpyCH4III	ACNGT	1 cut(s)	331
HpyCH4IV	ACGT	1 cut(s)	276
HpyCH4V	TGCA	1 cut(s)	55
HpySE526I	ACGT	1 cut(s)	276
Hsp92II	CATG	1 cut(s)	322
HspAI	GCGC	1 cut(s)	267
KpnI	GGTACC	1 cut(s)	335
LmnI	GCTCC	2 cut(s)	96, 102
LpnPI	CCDG	4 cut(s)	50, 181, 208, 285
LweI	GCATC	1 cut(s)	100
MaeII	ACGT	1 cut(s)	276
MbiI	CCGCTC	1 cut(s)	99
MboII	GAAGA	1 cut(s)	150
MluCI	AATT	3 cut(s)	15, 160, 217
MlyI	GAGTC	1 cut(s)	196
MmeI	TCCRAC	1 cut(s)	15
MnlI	CCTC	6 cut(s)	21, 31, 125, 125, 146, 198
MslI	CAYNNNNRTG	1 cut(s)	177
MspR9I	CCNGG	1 cut(s)	196
MvaI	CCWGG	1 cut(s)	196
NlaIII	CATG	1 cut(s)	322
NlaIV	GGNNCC	1 cut(s)	333
OliI	CACNNNNGTG	1 cut(s)	177
PcsI	WCGNNNNNNNCGW	1 cut(s)	255
PfeI	GAWTC	1 cut(s)	20
PleI	GAGTC	1 cut(s)	195
PpsI	GAGTC	1 cut(s)	195
PsiI	TTATAA	1 cut(s)	159
Psp6I	CCWGG	1 cut(s)	194
PspGI	CCWGG	1 cut(s)	194
PspN4I	GGNNCC	1 cut(s)	333
RsaI	GTAC	2 cut(s)	323, 333
RsaNI	GTAC	2 cut(s)	322, 332
RseI	CAYNNNNRTG	1 cut(s)	177
SchI	GAGTC	1 cut(s)	196
ScrFI	CCNGG	1 cut(s)	196
SetI	ASST	6 cut(s)	42, 136, 157, 209, 279, 293
SfaNI	GCATC	1 cut(s)	100
SmiMI	CAYNNNNRTG	1 cut(s)	177
Sse9I	AATT	3 cut(s)	15, 160, 217
SsiI	CCGC	1 cut(s)	99
StyD4I	CCNGG	1 cut(s)	194
TaaI	ACNGT	1 cut(s)	331
TaiI	ACGT	1 cut(s)	279
TasI	AATT	3 cut(s)	15, 160, 217
TfiI	GAWTC	1 cut(s)	20
TspDTI	ATGAA	1 cut(s)	228
TspGWI	ACGGA	8 cut(s)	84, 89, 104, 109, 163, 189, 297, 298
XapI	RAATTY	1 cut(s)	217

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.