Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Forward (+)

15645348 .. 15645774

Gene Structure 427 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g19700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 342 bp

ATGGATTTGAGTTACGGGACGGGACAGGACGGAACGGAACGGAGCGGGAGCAAAGATGTCATCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATATGGAACGAGTCGTTCCAGGAGGGTGAGGTGGAAAGAAAATTCACCCAAAACTCGTCCTGTGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACACCTTGTCCCACTCTGTTCCGTCCCGTTTCACGTACCAAACGGTACTGTATGGATCAGGGTTTTGTGACCAATTACGTCACTCATTACGTGAGTCATGTGACTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

114

Amino Acids

12.86

Weight (kDa)

10.65

Isoelectric Point (pI)

87.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	105
AccBSI	CCGCTC	1 cut(s)	45
AciI	CCGC	1 cut(s)	45
AclWI	GGATC	1 cut(s)	295
AcsI	RAATTY	1 cut(s)	163
AfaI	GTAC	2 cut(s)	269, 279
AfiI	CCNNNNNNNGG	2 cut(s)	209, 224
AjnI	CCWGG	1 cut(s)	140
AloI	GAACNNNNNNTCC	2 cut(s)	224, 256
AluBI	AGCT	1 cut(s)	193
AluI	AGCT	1 cut(s)	193
Alw26I	GTCTC	1 cut(s)	85
AlwI	GGATC	1 cut(s)	295
ApoI	RAATTY	1 cut(s)	163
AspLEI	GCGC	1 cut(s)	215
AsuHPI	GGTGA	2 cut(s)	159, 160
BccI	CCATC	1 cut(s)	60
BciT130I	CCWGG	1 cut(s)	142
BcoDI	GTCTC	1 cut(s)	85
Bme1390I	CCNGG	1 cut(s)	142
BmrFI	CCNGG	1 cut(s)	142
BsaAI	YACGTR	2 cut(s)	267, 323
BsaJI	CCNNGG	1 cut(s)	118
Bsc4I	CCNNNNNNNGG	2 cut(s)	209, 224
BseBI	CCWGG	1 cut(s)	142
BseDI	CCNNGG	1 cut(s)	118
BseGI	GGATG	1 cut(s)	71
BseLI	CCNNNNNNNGG	2 cut(s)	209, 224
BslFI	GGGAC	5 cut(s)	31, 36, 226, 240, 241
BslI	CCNNNNNNNGG	2 cut(s)	209, 224
BsmAI	GTCTC	1 cut(s)	85
BsmBI	CGTCTC	1 cut(s)	85
BsmFI	GGGAC	5 cut(s)	31, 36, 226, 240, 241
Bsp143I	GATC	1 cut(s)	287
BspACI	CCGC	1 cut(s)	45
BspPI	GGATC	1 cut(s)	295
BsrBI	CCGCTC	1 cut(s)	45
BssECI	CCNNGG	1 cut(s)	118
BssMI	GATC	1 cut(s)	287
Bst2UI	CCWGG	1 cut(s)	142
Bst4CI	ACNGT	2 cut(s)	277, 282
BstBAI	YACGTR	2 cut(s)	267, 323
BstDSI	CCRYGG	1 cut(s)	118
BstF5I	GGATG	1 cut(s)	71
BstHHI	GCGC	1 cut(s)	215
BstKTI	GATC	1 cut(s)	290
BstMAI	GTCTC	1 cut(s)	85
BstMBI	GATC	1 cut(s)	287
BstNI	CCWGG	1 cut(s)	142
BstSCI	CCNGG	1 cut(s)	140
BstXI	CCANNNNNNTGG	1 cut(s)	125
BtgI	CCRYGG	1 cut(s)	118
BtsCI	GGATG	1 cut(s)	71
CfoI	GCGC	1 cut(s)	215
Csp6I	GTAC	2 cut(s)	268, 278
CviAII	CATG	1 cut(s)	330
CviJI	RGCY	1 cut(s)	193
CviKI_1	RGCY	1 cut(s)	193
CviQI	GTAC	2 cut(s)	268, 278
DpnI	GATC	1 cut(s)	289
DpnII	GATC	1 cut(s)	287
EcoRII	CCWGG	1 cut(s)	140
Esp3I	CGTCTC	1 cut(s)	85
FaeI	CATG	1 cut(s)	333
FaiI	YATR	4 cut(s)	105, 126, 285, 331
FaqI	GGGAC	5 cut(s)	31, 36, 226, 240, 241
FatI	CATG	1 cut(s)	329
FauI	CCCGC	1 cut(s)	38
FokI	GGATG	1 cut(s)	78
GlaI	GCGC	1 cut(s)	214
HhaI	GCGC	1 cut(s)	215
Hin1II	CATG	1 cut(s)	333
Hin6I	GCGC	1 cut(s)	213
HinP1I	GCGC	1 cut(s)	213
HinfI	GANTC	2 cut(s)	133, 326
HphI	GGTGA	2 cut(s)	159, 160
Hpy188I	TCNGA	1 cut(s)	65
HpyAV	CCTTC	1 cut(s)	81
HpyCH4III	ACNGT	2 cut(s)	277, 282
HpyCH4IV	ACGT	4 cut(s)	222, 266, 310, 322
HpySE526I	ACGT	4 cut(s)	222, 266, 310, 322
Hsp92II	CATG	1 cut(s)	333
HspAI	GCGC	1 cut(s)	213
Kzo9I	GATC	1 cut(s)	287
LmnI	GCTCC	2 cut(s)	42, 48
LpnPI	CCDG	5 cut(s)	11, 127, 154, 195, 276
MaeII	ACGT	4 cut(s)	222, 266, 310, 322
MaeIII	GTNAC	4 cut(s)	11, 299, 311, 332
MalI	GATC	1 cut(s)	289
MbiI	CCGCTC	1 cut(s)	45
MboI	GATC	1 cut(s)	287
MboII	GAAGA	2 cut(s)	93, 96
MluCI	AATT	3 cut(s)	106, 163, 305
MlyI	GAGTC	2 cut(s)	142, 335
MnlI	CCTC	4 cut(s)	71, 92, 138, 144
MslI	CAYNNNNRTG	1 cut(s)	123
MspR9I	CCNGG	1 cut(s)	142
MvaI	CCWGG	1 cut(s)	142
NdeII	GATC	1 cut(s)	287
NlaIII	CATG	1 cut(s)	333
NmuCI	GTSAC	3 cut(s)	299, 311, 332
PcsI	WCGNNNNNNNCGW	1 cut(s)	201
PfoI	TCCNGGA	1 cut(s)	140
PleI	GAGTC	2 cut(s)	141, 334
PpsI	GAGTC	2 cut(s)	141, 334
Ppu21I	YACGTR	2 cut(s)	267, 323
PsiI	TTATAA	1 cut(s)	105
Psp6I	CCWGG	1 cut(s)	140
PspGI	CCWGG	1 cut(s)	140
RsaI	GTAC	2 cut(s)	269, 279
RsaNI	GTAC	2 cut(s)	268, 278
RseI	CAYNNNNRTG	1 cut(s)	123
Sau3AI	GATC	1 cut(s)	287
SchI	GAGTC	2 cut(s)	142, 335
ScrFI	CCNGG	1 cut(s)	142
SetI	ASST	8 cut(s)	103, 155, 195, 225, 239, 269, 313, 325
SmiMI	CAYNNNNRTG	1 cut(s)	123
Sse9I	AATT	3 cut(s)	106, 163, 305
SsiI	CCGC	1 cut(s)	45
StyD4I	CCNGG	1 cut(s)	140
TaaI	ACNGT	2 cut(s)	277, 282
TaiI	ACGT	4 cut(s)	225, 269, 313, 325
TasI	AATT	3 cut(s)	106, 163, 305
TseFI	GTSAC	3 cut(s)	299, 311, 332
Tsp45I	GTSAC	3 cut(s)	299, 311, 332
TspGWI	ACGGA	7 cut(s)	45, 50, 55, 109, 135, 243, 244
XapI	RAATTY	1 cut(s)	163

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.