Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr2

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

23560491 .. 23561151

Gene Structure 661 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom02g25680.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 489 bp

ATGAAAGAGGGGTGCTGGTCAATTCTAGGTATCGTTTGGAATGCAAATGGGATGGGACGGAACGGAATGGAACGGGACGGGACGGGACAGGACGGAATGGAACGGAACGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGATGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCCCCCAAAACTCGTCCCGTGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTCCGTCTCGTCCCACGTACCAAACGGTACCTAAACGAACAGGTAACTGTATGATCATCCTCTTTGAAATCGTAGTTCTCTTCCCCCTAGAAATGCAAGTTCTTGCGAATAATGATGTCCTTGATTTCAATGAGCAATGTTTTATCATTGTCAACTGTCGAGAATTAATGATGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

163

Amino Acids

18.3

Weight (kDa)

9.63

Isoelectric Point (pI)

59.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	168
Acc65I	GGTACC	1 cut(s)	340
AccB1I	GGYRCC	1 cut(s)	340
AcsI	RAATTY	1 cut(s)	226
AfaI	GTAC	2 cut(s)	332, 342
AfiI	CCNNNNNNNGG	3 cut(s)	129, 272, 287
AgsI	TTSAA	2 cut(s)	380, 442
AjnI	CCWGG	1 cut(s)	203
AleI	CACNNNNGTG	1 cut(s)	186
AloI	GAACNNNNNNTCC	4 cut(s)	212, 244, 287, 319
AluBI	AGCT	1 cut(s)	256
AluI	AGCT	1 cut(s)	256
Alw26I	GTCTC	2 cut(s)	148, 324
ApoI	RAATTY	1 cut(s)	226
AseI	ATTAAT	1 cut(s)	479
Asp718I	GGTACC	1 cut(s)	340
AspLEI	GCGC	1 cut(s)	278
AsuHPI	GGTGA	1 cut(s)	223
BanI	GGYRCC	1 cut(s)	340
BccI	CCATC	2 cut(s)	46, 123
BciT130I	CCWGG	1 cut(s)	205
BclI	TGATCA	1 cut(s)	366
BcoDI	GTCTC	2 cut(s)	148, 324
BfaI	CTAG	2 cut(s)	26, 401
Bme1390I	CCNGG	1 cut(s)	205
BmiI	GGNNCC	1 cut(s)	342
BmrFI	CCNGG	1 cut(s)	205
BmsI	GCATC	1 cut(s)	109
BsaAI	YACGTR	1 cut(s)	330
BsaJI	CCNNGG	4 cut(s)	124, 181, 204, 246
Bsc4I	CCNNNNNNNGG	3 cut(s)	129, 272, 287
Bse3DI	GCAATG	1 cut(s)	455
BseBI	CCWGG	1 cut(s)	205
BseDI	CCNNGG	4 cut(s)	124, 181, 204, 246
BseGI	GGATG	4 cut(s)	57, 134, 191, 369
BseLI	CCNNNNNNNGG	3 cut(s)	129, 272, 287
BseMI	GCAATG	1 cut(s)	455
BshNI	GGYRCC	1 cut(s)	340
BslFI	GGGAC	8 cut(s)	69, 89, 94, 99, 228, 289, 303, 309
BslI	CCNNNNNNNGG	3 cut(s)	129, 272, 287
BsmAI	GTCTC	2 cut(s)	148, 324
BsmBI	CGTCTC	2 cut(s)	148, 324
BsmFI	GGGAC	8 cut(s)	69, 89, 94, 99, 228, 289, 303, 309
BsmI	GAATGC	1 cut(s)	46
Bsp143I	GATC	1 cut(s)	366
BspLI	GGNNCC	1 cut(s)	342
BspT107I	GGYRCC	1 cut(s)	340
BsrDI	GCAATG	1 cut(s)	455
BssECI	CCNNGG	4 cut(s)	124, 181, 204, 246
BssMI	GATC	1 cut(s)	366
Bst2UI	CCWGG	1 cut(s)	205
Bst4CI	ACNGT	3 cut(s)	340, 362, 470
Bst6I	CTCTTC	1 cut(s)	398
BstBAI	YACGTR	1 cut(s)	330
BstDSI	CCRYGG	2 cut(s)	181, 246
BstF5I	GGATG	4 cut(s)	57, 134, 191, 369
BstHHI	GCGC	1 cut(s)	278
BstKTI	GATC	1 cut(s)	369
BstMAI	GTCTC	2 cut(s)	148, 324
BstMBI	GATC	1 cut(s)	366
BstNI	CCWGG	1 cut(s)	205
BstSCI	CCNGG	1 cut(s)	203
BstXI	CCANNNNNNTGG	1 cut(s)	188
BtgI	CCRYGG	2 cut(s)	181, 246
BtsCI	GGATG	4 cut(s)	57, 134, 191, 369
CfoI	GCGC	1 cut(s)	278
Csp6I	GTAC	2 cut(s)	331, 341
CviJI	RGCY	1 cut(s)	256
CviKI_1	RGCY	1 cut(s)	256
CviQI	GTAC	2 cut(s)	331, 341
DpnI	GATC	1 cut(s)	368
DpnII	GATC	1 cut(s)	366
Eam1104I	CTCTTC	1 cut(s)	398
EarI	CTCTTC	1 cut(s)	398
EcoRII	CCWGG	1 cut(s)	203
Esp3I	CGTCTC	2 cut(s)	148, 324
FaiI	YATR	2 cut(s)	168, 365
FaqI	GGGAC	8 cut(s)	69, 89, 94, 99, 228, 289, 303, 309
FbaI	TGATCA	1 cut(s)	366
FokI	GGATG	4 cut(s)	64, 141, 198, 356
FspBI	CTAG	2 cut(s)	26, 401
GlaI	GCGC	1 cut(s)	277
HhaI	GCGC	1 cut(s)	278
Hin6I	GCGC	1 cut(s)	276
HinP1I	GCGC	1 cut(s)	276
HincII	GTYRAC	1 cut(s)	466
HindII	GTYRAC	1 cut(s)	466
HinfI	GANTC	1 cut(s)	196
HphI	GGTGA	1 cut(s)	223
Hpy166II	GTNNAC	1 cut(s)	466
Hpy188I	TCNGA	1 cut(s)	128
Hpy188III	TCNNGA	1 cut(s)	473
Hpy8I	GTNNAC	1 cut(s)	466
HpyAV	CCTTC	1 cut(s)	144
HpyCH4III	ACNGT	3 cut(s)	340, 362, 470
HpyCH4IV	ACGT	2 cut(s)	285, 329
HpyCH4V	TGCA	2 cut(s)	44, 409
HpySE526I	ACGT	2 cut(s)	285, 329
HspAI	GCGC	1 cut(s)	276
KpnI	GGTACC	1 cut(s)	344
Ksp22I	TGATCA	1 cut(s)	366
Kzo9I	GATC	1 cut(s)	366
LmnI	GCTCC	1 cut(s)	111
LpnPI	CCDG	4 cut(s)	74, 190, 217, 339
LweI	GCATC	1 cut(s)	109
MaeI	CTAG	2 cut(s)	26, 401
MaeII	ACGT	2 cut(s)	285, 329
MaeIII	GTNAC	1 cut(s)	356
MalI	GATC	1 cut(s)	368
MboI	GATC	1 cut(s)	366
MboII	GAAGA	3 cut(s)	156, 159, 385
MluCI	AATT	4 cut(s)	21, 169, 226, 476
MlyI	GAGTC	1 cut(s)	205
MnlI	CCTC	4 cut(s)	134, 134, 207, 383
MseI	TTAA	1 cut(s)	479
MslI	CAYNNNNRTG	1 cut(s)	186
MspR9I	CCNGG	1 cut(s)	205
Mva1269I	GAATGC	1 cut(s)	46
MvaI	CCWGG	1 cut(s)	205
NdeII	GATC	1 cut(s)	366
NlaIV	GGNNCC	1 cut(s)	342
OliI	CACNNNNGTG	1 cut(s)	186
PcsI	WCGNNNNNNNCGW	1 cut(s)	264
PctI	GAATGC	1 cut(s)	46
PleI	GAGTC	1 cut(s)	204
PpsI	GAGTC	1 cut(s)	204
Ppu21I	YACGTR	1 cut(s)	330
PshBI	ATTAAT	1 cut(s)	479
PsiI	TTATAA	1 cut(s)	168
Psp6I	CCWGG	1 cut(s)	203
PspGI	CCWGG	1 cut(s)	203
PspN4I	GGNNCC	1 cut(s)	342
RsaI	GTAC	2 cut(s)	332, 342
RsaNI	GTAC	2 cut(s)	331, 341
RseI	CAYNNNNRTG	1 cut(s)	186
SaqAI	TTAA	1 cut(s)	479
Sau3AI	GATC	1 cut(s)	366
SchI	GAGTC	1 cut(s)	205
ScrFI	CCNGG	1 cut(s)	205
SetI	ASST	7 cut(s)	31, 218, 258, 288, 332, 346, 358
SfaNI	GCATC	1 cut(s)	109
SmiMI	CAYNNNNRTG	1 cut(s)	186
Sse9I	AATT	4 cut(s)	21, 169, 226, 476
SspMI	CTAG	2 cut(s)	26, 401
StyD4I	CCNGG	1 cut(s)	203
TaaI	ACNGT	3 cut(s)	340, 362, 470
TaiI	ACGT	2 cut(s)	288, 332
TaqI	TCGA	1 cut(s)	472
TasI	AATT	4 cut(s)	21, 169, 226, 476
Tru1I	TTAA	1 cut(s)	479
Tru9I	TTAA	1 cut(s)	479
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	8 cut(s)	73, 78, 108, 118, 172, 198, 306, 307
VspI	ATTAAT	1 cut(s)	479
XapI	RAATTY	1 cut(s)	226
XspI	CTAG	2 cut(s)	26, 401

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.