Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr16

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Forward (+)

6079165 .. 6079653

Gene Structure 489 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom16g09070.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 444 bp

ATGAACGAGCATGTGATCTGTATCGTTTGGTATGCAGACGGGACGGGACGGAACGGAATGGGATGGGACGGGACGGGACAGGACGGAACGGAACGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGTTGAGGTGGAATGAAAATTCACCCAAAACTCGTCCCGTGGAACAGCTCGTTCCACCCGTTTTAAGAGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTCCGTCCCGTCCCACGTACCAAACGGTACCTAAAGCTTTGTTTTTTGGAGTAGGATTCTTTCATCTCATTCCCTTCCCTTCTCTTACAGTTTGTTTTTTATCATATTGTCTCTATAAAAAAATTAATATAAGATGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

148

Amino Acids

16.57

Weight (kDa)

10.39

Isoelectric Point (pI)

70.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	159
Acc65I	GGTACC	1 cut(s)	331
AccB1I	GGYRCC	1 cut(s)	331
AccBSI	CCGCTC	1 cut(s)	99
AciI	CCGC	1 cut(s)	99
AcsI	RAATTY	1 cut(s)	217
AfaI	GTAC	2 cut(s)	323, 333
AfiI	CCNNNNNNNGG	2 cut(s)	120, 278
AjnI	CCWGG	1 cut(s)	194
AleI	CACNNNNGTG	1 cut(s)	177
AloI	GAACNNNNNNTCC	2 cut(s)	278, 310
AluBI	AGCT	2 cut(s)	247, 341
AluI	AGCT	2 cut(s)	247, 341
Alw21I	GWGCWC	1 cut(s)	271
Alw26I	GTCTC	2 cut(s)	139, 419
ApoI	RAATTY	1 cut(s)	217
AseI	ATTAAT	1 cut(s)	429
Asp718I	GGTACC	1 cut(s)	331
AsuHPI	GGTGA	1 cut(s)	213
BanI	GGYRCC	1 cut(s)	331
Bbv12I	GWGCWC	1 cut(s)	271
BccI	CCATC	2 cut(s)	57, 114
BciT130I	CCWGG	1 cut(s)	196
BcoDI	GTCTC	2 cut(s)	139, 419
Bme1390I	CCNGG	1 cut(s)	196
BmiI	GGNNCC	1 cut(s)	333
BmrFI	CCNGG	1 cut(s)	196
BmsI	GCATC	1 cut(s)	100
BsaAI	YACGTR	1 cut(s)	321
BsaBI	GATNNNNATC	1 cut(s)	20
BsaJI	CCNNGG	4 cut(s)	115, 172, 195, 237
Bsc4I	CCNNNNNNNGG	2 cut(s)	120, 278
Bse8I	GATNNNNATC	1 cut(s)	20
BseBI	CCWGG	1 cut(s)	196
BseDI	CCNNGG	4 cut(s)	115, 172, 195, 237
BseGI	GGATG	3 cut(s)	68, 125, 182
BseJI	GATNNNNATC	1 cut(s)	20
BseLI	CCNNNNNNNGG	2 cut(s)	120, 278
BshNI	GGYRCC	1 cut(s)	331
BsiHKAI	GWGCWC	1 cut(s)	271
BslI	CCNNNNNNNGG	2 cut(s)	120, 278
BsmAI	GTCTC	2 cut(s)	139, 419
BsmBI	CGTCTC	1 cut(s)	139
Bsp1286I	GDGCHC	1 cut(s)	271
Bsp143I	GATC	1 cut(s)	15
BspACI	CCGC	1 cut(s)	99
BspLI	GGNNCC	1 cut(s)	333
BspT107I	GGYRCC	1 cut(s)	331
BsrBI	CCGCTC	1 cut(s)	99
BssECI	CCNNGG	4 cut(s)	115, 172, 195, 237
BssMI	GATC	1 cut(s)	15
Bst2UI	CCWGG	1 cut(s)	196
Bst4CI	ACNGT	2 cut(s)	331, 394
BstBAI	YACGTR	1 cut(s)	321
BstDSI	CCRYGG	2 cut(s)	172, 237
BstF5I	GGATG	3 cut(s)	68, 125, 182
BstKTI	GATC	1 cut(s)	18
BstMAI	GTCTC	2 cut(s)	139, 419
BstMBI	GATC	1 cut(s)	15
BstNI	CCWGG	1 cut(s)	196
BstNSI	RCATGY	1 cut(s)	14
BstSCI	CCNGG	1 cut(s)	194
BstXI	CCANNNNNNTGG	1 cut(s)	179
BtgI	CCRYGG	2 cut(s)	172, 237
BtsCI	GGATG	3 cut(s)	68, 125, 182
Csp6I	GTAC	2 cut(s)	322, 332
CviAII	CATG	1 cut(s)	11
CviJI	RGCY	2 cut(s)	247, 341
CviKI_1	RGCY	2 cut(s)	247, 341
CviQI	GTAC	2 cut(s)	322, 332
DpnI	GATC	1 cut(s)	17
DpnII	GATC	1 cut(s)	15
EcoRII	CCWGG	1 cut(s)	194
Esp3I	CGTCTC	1 cut(s)	139
FaeI	CATG	1 cut(s)	14
FaiI	YATR	6 cut(s)	12, 33, 159, 409, 420, 434
FatI	CATG	1 cut(s)	10
FauI	CCCGC	1 cut(s)	92
FokI	GGATG	3 cut(s)	75, 132, 189
Hin1II	CATG	1 cut(s)	14
HindIII	AAGCTT	1 cut(s)	339
HinfI	GANTC	2 cut(s)	187, 360
HphI	GGTGA	1 cut(s)	213
Hpy188I	TCNGA	1 cut(s)	119
HpyAV	CCTTC	3 cut(s)	135, 388, 393
HpyCH4III	ACNGT	2 cut(s)	331, 394
HpyCH4IV	ACGT	2 cut(s)	276, 320
HpyCH4V	TGCA	1 cut(s)	35
HpySE526I	ACGT	2 cut(s)	276, 320
Hsp92II	CATG	1 cut(s)	14
KpnI	GGTACC	1 cut(s)	335
Kzo9I	GATC	1 cut(s)	15
LmnI	GCTCC	2 cut(s)	96, 102
LpnPI	CCDG	3 cut(s)	65, 181, 208
LweI	GCATC	1 cut(s)	100
MaeII	ACGT	2 cut(s)	276, 320
MalI	GATC	1 cut(s)	17
MbiI	CCGCTC	1 cut(s)	99
MboI	GATC	1 cut(s)	15
MboII	GAAGA	2 cut(s)	147, 150
MhlI	GDGCHC	1 cut(s)	271
MluCI	AATT	3 cut(s)	160, 217, 426
MlyI	GAGTC	1 cut(s)	196
MnlI	CCTC	4 cut(s)	125, 125, 146, 198
MseI	TTAA	2 cut(s)	263, 429
MslI	CAYNNNNRTG	1 cut(s)	177
MspR9I	CCNGG	1 cut(s)	196
MvaI	CCWGG	1 cut(s)	196
NdeII	GATC	1 cut(s)	15
NlaIII	CATG	1 cut(s)	14
NlaIV	GGNNCC	1 cut(s)	333
NspI	RCATGY	1 cut(s)	14
OliI	CACNNNNGTG	1 cut(s)	177
PcsI	WCGNNNNNNNCGW	1 cut(s)	255
PfeI	GAWTC	1 cut(s)	360
PleI	GAGTC	1 cut(s)	195
PpsI	GAGTC	1 cut(s)	195
Ppu21I	YACGTR	1 cut(s)	321
PshBI	ATTAAT	1 cut(s)	429
PsiI	TTATAA	1 cut(s)	159
Psp6I	CCWGG	1 cut(s)	194
PspGI	CCWGG	1 cut(s)	194
PspN4I	GGNNCC	1 cut(s)	333
RsaI	GTAC	2 cut(s)	323, 333
RsaNI	GTAC	2 cut(s)	322, 332
RseI	CAYNNNNRTG	1 cut(s)	177
SaqAI	TTAA	2 cut(s)	263, 429
Sau3AI	GATC	1 cut(s)	15
SchI	GAGTC	1 cut(s)	196
ScrFI	CCNGG	1 cut(s)	196
SduI	GDGCHC	1 cut(s)	271
SetI	ASST	7 cut(s)	157, 209, 249, 279, 323, 337, 343
SfaNI	GCATC	1 cut(s)	100
SmiMI	CAYNNNNRTG	1 cut(s)	177
Sse9I	AATT	3 cut(s)	160, 217, 426
SsiI	CCGC	1 cut(s)	99
StyD4I	CCNGG	1 cut(s)	194
TaaI	ACNGT	2 cut(s)	331, 394
TaiI	ACGT	2 cut(s)	279, 323
TasI	AATT	3 cut(s)	160, 217, 426
TfiI	GAWTC	1 cut(s)	360
Tru1I	TTAA	2 cut(s)	263, 429
Tru9I	TTAA	2 cut(s)	263, 429
TspDTI	ATGAA	3 cut(s)	17, 228, 356
TspGWI	ACGGA	9 cut(s)	64, 69, 99, 104, 109, 163, 189, 297, 298
VspI	ATTAAT	1 cut(s)	429
XapI	RAATTY	1 cut(s)	217
XceI	RCATGY	1 cut(s)	14

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.