Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr5

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Forward (+)

17740381 .. 17743809

Gene Structure 3429 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom05g14220.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 594 bp

ATGCATGTATTAGAACGCTTTAAGCAGAACGGCAGTAATATAGGTATCGTTTGGTATGCAGACGGGACGGGACGGAACGGAATGGGACGGGACGGGACGGGACAGGACGAAACGGAACGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCACCCAAAACTCGTCCCGTGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTTCGTCCCGTCCCGCGTACCAAACGGTACAAGAGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTCCGTCCTGTCCCACGTTCCAAACGGTACCATAATGTTTCCAGCTCTTATAGCTGCTGTGGTGTTTCTTTTCTCATTTTGACTCATCACTTTTGCAAAAAAGATGTTAGACACGTTTTGTTGTTGTATAAACATGAGTGGAACATAATATTGTTGATTTTATACATCAAATTGCATTTCTTTTTTTATAGGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

198

Amino Acids

22.64

Weight (kDa)

10.25

Isoelectric Point (pI)

67.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	183
Acc65I	GGTACC	1 cut(s)	426
AccB1I	GGYRCC	1 cut(s)	426
AccBSI	CCGCTC	1 cut(s)	123
AccII	CGCG	1 cut(s)	344
AciI	CCGC	2 cut(s)	123, 342
AcsI	RAATTY	1 cut(s)	241
AfaI	GTAC	3 cut(s)	347, 357, 428
AfiI	CCNNNNNNNGG	4 cut(s)	144, 287, 302, 373
AflIII	ACRYGT	1 cut(s)	511
AjnI	CCWGG	1 cut(s)	218
AleI	CACNNNNGTG	1 cut(s)	201
AloI	GAACNNNNNNTCC	4 cut(s)	302, 334, 373, 405
AluBI	AGCT	3 cut(s)	271, 444, 453
AluI	AGCT	3 cut(s)	271, 444, 453
Alw21I	GWGCWC	1 cut(s)	366
Alw26I	GTCTC	1 cut(s)	163
ApeKI	GCWGC	1 cut(s)	453
ApoI	RAATTY	1 cut(s)	241
Asp718I	GGTACC	1 cut(s)	426
AspLEI	GCGC	1 cut(s)	293
AsuHPI	GGTGA	2 cut(s)	237, 238
BanI	GGYRCC	1 cut(s)	426
Bbv12I	GWGCWC	1 cut(s)	366
BbvI	GCAGC	1 cut(s)	440
BccI	CCATC	1 cut(s)	138
BceAI	ACGGC	1 cut(s)	46
BciT130I	CCWGG	1 cut(s)	220
BcoDI	GTCTC	1 cut(s)	163
BisI	GCNGC	1 cut(s)	454
BlsI	GCNGC	1 cut(s)	455
Bme1390I	CCNGG	1 cut(s)	220
BmiI	GGNNCC	1 cut(s)	428
BmrFI	CCNGG	1 cut(s)	220
BmsI	GCATC	1 cut(s)	124
BsaJI	CCNNGG	4 cut(s)	139, 196, 219, 261
Bsc4I	CCNNNNNNNGG	4 cut(s)	144, 287, 302, 373
BseBI	CCWGG	1 cut(s)	220
BseDI	CCNNGG	4 cut(s)	139, 196, 219, 261
BseGI	GGATG	2 cut(s)	149, 206
BseLI	CCNNNNNNNGG	4 cut(s)	144, 287, 302, 373
BseXI	GCAGC	1 cut(s)	440
Bsh1236I	CGCG	1 cut(s)	344
BshNI	GGYRCC	1 cut(s)	426
BsiHKAI	GWGCWC	1 cut(s)	366
BslI	CCNNNNNNNGG	4 cut(s)	144, 287, 302, 373
BsmAI	GTCTC	1 cut(s)	163
BsmBI	CGTCTC	1 cut(s)	163
Bsp1286I	GDGCHC	1 cut(s)	366
BspACI	CCGC	2 cut(s)	123, 342
BspFNI	CGCG	1 cut(s)	344
BspLI	GGNNCC	1 cut(s)	428
BspT107I	GGYRCC	1 cut(s)	426
BsrBI	CCGCTC	1 cut(s)	123
BssECI	CCNNGG	4 cut(s)	139, 196, 219, 261
Bst2UI	CCWGG	1 cut(s)	220
Bst4CI	ACNGT	2 cut(s)	355, 426
BstDSI	CCRYGG	2 cut(s)	196, 261
BstF5I	GGATG	2 cut(s)	149, 206
BstFNI	CGCG	1 cut(s)	344
BstHHI	GCGC	1 cut(s)	293
BstMAI	GTCTC	1 cut(s)	163
BstMWI	GCNNNNNNNGC	1 cut(s)	450
BstNI	CCWGG	1 cut(s)	220
BstNSI	RCATGY	1 cut(s)	8
BstSCI	CCNGG	1 cut(s)	218
BstUI	CGCG	1 cut(s)	344
BstV1I	GCAGC	1 cut(s)	440
BstXI	CCANNNNNNTGG	1 cut(s)	203
BtgI	CCRYGG	2 cut(s)	196, 261
BtsCI	GGATG	2 cut(s)	149, 206
CfoI	GCGC	1 cut(s)	293
Csp6I	GTAC	3 cut(s)	346, 356, 427
CviAII	CATG	2 cut(s)	5, 533
CviJI	RGCY	3 cut(s)	271, 444, 453
CviKI_1	RGCY	3 cut(s)	271, 444, 453
CviQI	GTAC	3 cut(s)	346, 356, 427
EcoRII	CCWGG	1 cut(s)	218
EcoT22I	ATGCAT	1 cut(s)	6
Esp3I	CGTCTC	1 cut(s)	163
FaeI	CATG	2 cut(s)	8, 536
FatI	CATG	2 cut(s)	4, 532
FauI	CCCGC	2 cut(s)	116, 349
Fnu4HI	GCNGC	1 cut(s)	454
FokI	GGATG	2 cut(s)	156, 213
Fsp4HI	GCNGC	1 cut(s)	454
GlaI	GCGC	1 cut(s)	292
GluI	GCNGC	1 cut(s)	454
HhaI	GCGC	1 cut(s)	293
Hin1II	CATG	2 cut(s)	8, 536
Hin6I	GCGC	1 cut(s)	291
HinP1I	GCGC	1 cut(s)	291
HinfI	GANTC	2 cut(s)	211, 481
HphI	GGTGA	2 cut(s)	237, 238
Hpy188I	TCNGA	1 cut(s)	143
HpyAV	CCTTC	1 cut(s)	159
HpyCH4III	ACNGT	2 cut(s)	355, 426
HpyCH4IV	ACGT	4 cut(s)	300, 371, 415, 513
HpyCH4V	TGCA	4 cut(s)	4, 59, 495, 574
HpyF10VI	GCNNNNNNNGC	1 cut(s)	450
HpySE526I	ACGT	4 cut(s)	300, 371, 415, 513
Hsp92II	CATG	2 cut(s)	8, 536
HspAI	GCGC	1 cut(s)	291
KpnI	GGTACC	1 cut(s)	430
LmnI	GCTCC	2 cut(s)	120, 126
LpnPI	CCDG	5 cut(s)	89, 205, 232, 420, 454
Lsp1109I	GCAGC	1 cut(s)	440
LweI	GCATC	1 cut(s)	124
MaeII	ACGT	4 cut(s)	300, 371, 415, 513
MbiI	CCGCTC	1 cut(s)	123
MboII	GAAGA	2 cut(s)	171, 174
MhlI	GDGCHC	1 cut(s)	366
MluCI	AATT	3 cut(s)	184, 241, 569
MlyI	GAGTC	2 cut(s)	220, 475
MnlI	CCTC	4 cut(s)	149, 149, 170, 222
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	1 cut(s)	21
MslI	CAYNNNNRTG	1 cut(s)	201
MspR9I	CCNGG	1 cut(s)	220
MvaI	CCWGG	1 cut(s)	220
MvnI	CGCG	1 cut(s)	344
MwoI	GCNNNNNNNGC	1 cut(s)	450
NlaIII	CATG	2 cut(s)	8, 536
NlaIV	GGNNCC	1 cut(s)	428
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	1 cut(s)	8
OliI	CACNNNNGTG	1 cut(s)	201
PcsI	WCGNNNNNNNCGW	1 cut(s)	279
PkrI	GCNGC	1 cut(s)	455
PleI	GAGTC	2 cut(s)	219, 475
PpsI	GAGTC	2 cut(s)	219, 475
PsiI	TTATAA	1 cut(s)	183
Psp6I	CCWGG	1 cut(s)	218
PspGI	CCWGG	1 cut(s)	218
PspN4I	GGNNCC	1 cut(s)	428
RsaI	GTAC	3 cut(s)	347, 357, 428
RsaNI	GTAC	3 cut(s)	346, 356, 427
RseI	CAYNNNNRTG	1 cut(s)	201
SaqAI	TTAA	1 cut(s)	21
SatI	GCNGC	1 cut(s)	454
SchI	GAGTC	2 cut(s)	220, 475
ScrFI	CCNGG	1 cut(s)	220
SduI	GDGCHC	1 cut(s)	366
SfaNI	GCATC	1 cut(s)	124
SmiMI	CAYNNNNRTG	1 cut(s)	201
Sse9I	AATT	3 cut(s)	184, 241, 569
SsiI	CCGC	2 cut(s)	123, 342
SspI	AATATT	1 cut(s)	549
StyD4I	CCNGG	1 cut(s)	218
TaaI	ACNGT	2 cut(s)	355, 426
TaiI	ACGT	4 cut(s)	303, 374, 418, 516
TasI	AATT	3 cut(s)	184, 241, 569
Tru1I	TTAA	1 cut(s)	21
Tru9I	TTAA	1 cut(s)	21
TseI	GCWGC	1 cut(s)	453
TspGWI	ACGGA	9 cut(s)	88, 93, 128, 133, 187, 213, 322, 392, 393
XapI	RAATTY	1 cut(s)	241
XceI	RCATGY	1 cut(s)	8
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.