Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr2

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

1663200 .. 1663478

Gene Structure 279 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom02g02660.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

ATGAAATGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCACCCAAAACTCATCATGTGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTCCGTCCCGTCCCACGTACCAAACGGTACATTACTTTCTACAAAAATTAAATCAATTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

93

Amino Acids

10.57

Weight (kDa)

11.61

Isoelectric Point (pI)

85.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	72
AccBSI	CCGCTC	1 cut(s)	12
AciI	CCGC	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	130
AfaI	GTAC	2 cut(s)	236, 246
AfiI	CCNNNNNNNGG	3 cut(s)	33, 176, 191
AjnI	CCWGG	1 cut(s)	107
AleI	CACNNNNGTG	1 cut(s)	90
AloI	GAACNNNNNNTCC	2 cut(s)	191, 223
AluBI	AGCT	1 cut(s)	160
AluI	AGCT	1 cut(s)	160
Alw26I	GTCTC	1 cut(s)	52
ApoI	RAATTY	1 cut(s)	130
AspLEI	GCGC	1 cut(s)	182
AsuHPI	GGTGA	2 cut(s)	126, 127
BccI	CCATC	1 cut(s)	27
BciT130I	CCWGG	1 cut(s)	109
BcoDI	GTCTC	1 cut(s)	52
Bme1390I	CCNGG	1 cut(s)	109
BmrFI	CCNGG	1 cut(s)	109
BmsI	GCATC	1 cut(s)	13
BsaAI	YACGTR	1 cut(s)	234
BsaJI	CCNNGG	3 cut(s)	28, 85, 108
Bsc4I	CCNNNNNNNGG	3 cut(s)	33, 176, 191
BseBI	CCWGG	1 cut(s)	109
BseDI	CCNNGG	3 cut(s)	28, 85, 108
BseGI	GGATG	2 cut(s)	38, 95
BseLI	CCNNNNNNNGG	3 cut(s)	33, 176, 191
BslFI	GGGAC	4 cut(s)	193, 207, 208, 213
BslI	CCNNNNNNNGG	3 cut(s)	33, 176, 191
BsmAI	GTCTC	1 cut(s)	52
BsmBI	CGTCTC	1 cut(s)	52
BsmFI	GGGAC	4 cut(s)	193, 207, 208, 213
BspACI	CCGC	1 cut(s)	12
BsrBI	CCGCTC	1 cut(s)	12
BssECI	CCNNGG	3 cut(s)	28, 85, 108
Bst2UI	CCWGG	1 cut(s)	109
Bst4CI	ACNGT	1 cut(s)	244
BstBAI	YACGTR	1 cut(s)	234
BstDSI	CCRYGG	1 cut(s)	85
BstF5I	GGATG	2 cut(s)	38, 95
BstHHI	GCGC	1 cut(s)	182
BstMAI	GTCTC	1 cut(s)	52
BstNI	CCWGG	1 cut(s)	109
BstSCI	CCNGG	1 cut(s)	107
BstXI	CCANNNNNNTGG	1 cut(s)	92
BtgI	CCRYGG	1 cut(s)	85
BtsCI	GGATG	2 cut(s)	38, 95
CfoI	GCGC	1 cut(s)	182
Csp6I	GTAC	2 cut(s)	235, 245
CviAII	CATG	1 cut(s)	149
CviJI	RGCY	1 cut(s)	160
CviKI_1	RGCY	1 cut(s)	160
CviQI	GTAC	2 cut(s)	235, 245
EcoRII	CCWGG	1 cut(s)	107
Esp3I	CGTCTC	1 cut(s)	52
FaeI	CATG	1 cut(s)	152
FaiI	YATR	2 cut(s)	72, 150
FaqI	GGGAC	4 cut(s)	193, 207, 208, 213
FatI	CATG	1 cut(s)	148
FauI	CCCGC	1 cut(s)	5
FokI	GGATG	2 cut(s)	45, 102
GlaI	GCGC	1 cut(s)	181
HhaI	GCGC	1 cut(s)	182
Hin1II	CATG	1 cut(s)	152
Hin6I	GCGC	1 cut(s)	180
HinP1I	GCGC	1 cut(s)	180
HinfI	GANTC	1 cut(s)	100
HphI	GGTGA	2 cut(s)	126, 127
Hpy188I	TCNGA	1 cut(s)	32
HpyAV	CCTTC	1 cut(s)	48
HpyCH4III	ACNGT	1 cut(s)	244
HpyCH4IV	ACGT	2 cut(s)	189, 233
HpySE526I	ACGT	2 cut(s)	189, 233
Hsp92II	CATG	1 cut(s)	152
HspAI	GCGC	1 cut(s)	180
LmnI	GCTCC	2 cut(s)	9, 15
LpnPI	CCDG	2 cut(s)	94, 121
LweI	GCATC	1 cut(s)	13
MaeII	ACGT	2 cut(s)	189, 233
MbiI	CCGCTC	1 cut(s)	12
MboII	GAAGA	2 cut(s)	60, 63
MluCI	AATT	4 cut(s)	73, 130, 263, 272
MlyI	GAGTC	1 cut(s)	109
MnlI	CCTC	4 cut(s)	38, 38, 59, 111
MseI	TTAA	2 cut(s)	266, 277
MslI	CAYNNNNRTG	1 cut(s)	90
MspR9I	CCNGG	1 cut(s)	109
MvaI	CCWGG	1 cut(s)	109
NlaIII	CATG	1 cut(s)	152
OliI	CACNNNNGTG	1 cut(s)	90
PcsI	WCGNNNNNNNCGW	1 cut(s)	168
PleI	GAGTC	1 cut(s)	108
PpsI	GAGTC	1 cut(s)	108
Ppu21I	YACGTR	1 cut(s)	234
PsiI	TTATAA	1 cut(s)	72
Psp6I	CCWGG	1 cut(s)	107
PspGI	CCWGG	1 cut(s)	107
RsaI	GTAC	2 cut(s)	236, 246
RsaNI	GTAC	2 cut(s)	235, 245
RseI	CAYNNNNRTG	1 cut(s)	90
SaqAI	TTAA	2 cut(s)	266, 277
SchI	GAGTC	1 cut(s)	109
ScrFI	CCNGG	1 cut(s)	109
SetI	ASST	5 cut(s)	70, 122, 162, 192, 236
SfaNI	GCATC	1 cut(s)	13
SmiMI	CAYNNNNRTG	1 cut(s)	90
Sse9I	AATT	4 cut(s)	73, 130, 263, 272
SsiI	CCGC	1 cut(s)	12
StyD4I	CCNGG	1 cut(s)	107
TaaI	ACNGT	1 cut(s)	244
TaiI	ACGT	2 cut(s)	192, 236
TasI	AATT	4 cut(s)	73, 130, 263, 272
Tru1I	TTAA	2 cut(s)	266, 277
Tru9I	TTAA	2 cut(s)	266, 277
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	4 cut(s)	76, 102, 210, 211
XapI	RAATTY	1 cut(s)	130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.