Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr10

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

27908482 .. 27908844

Gene Structure 363 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom10g26630.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 363 bp

ATGGAATTCGAATTTACATTGATTGTTGTTAAGGTTCACTTAGGTATCGTTTGGTATGCAGACGGGACGGGACGGAACGGAATGAGACGGAACGGGACGGGACAGGACGGAACGGAACGAAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGATGGAGACGGAGAGGTTATAATTCTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCACTCAAAACTCGTCCCATGGAACAGCTCGTTCCACCCGTTTTAAGCGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTCCGTCCCGTCCCACGTACCAAACGGTACCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

121

Amino Acids

13.42

Weight (kDa)

11.27

Isoelectric Point (pI)

63.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	183
Acc65I	GGTACC	1 cut(s)	355
AccB1I	GGYRCC	1 cut(s)	355
AciI	CCGC	1 cut(s)	123
AcsI	RAATTY	3 cut(s)	5, 11, 241
AfaI	GTAC	2 cut(s)	347, 357
AfiI	CCNNNNNNNGG	2 cut(s)	144, 302
AjnI	CCWGG	1 cut(s)	218
AleI	CACNNNNGTG	1 cut(s)	201
AloI	GAACNNNNNNTCC	2 cut(s)	302, 334
AluBI	AGCT	1 cut(s)	271
AluI	AGCT	1 cut(s)	271
Alw26I	GTCTC	2 cut(s)	79, 163
ApoI	RAATTY	3 cut(s)	5, 11, 241
Asp718I	GGTACC	1 cut(s)	355
AspLEI	GCGC	1 cut(s)	293
AsuHPI	GGTGA	1 cut(s)	238
AsuII	TTCGAA	1 cut(s)	9
BaeI	ACNNNNGTAYC	2 cut(s)	28, 61
BanI	GGYRCC	1 cut(s)	355
BccI	CCATC	2 cut(s)	138, 159
BciT130I	CCWGG	1 cut(s)	220
BcoDI	GTCTC	2 cut(s)	79, 163
Bme1390I	CCNGG	1 cut(s)	220
BmiI	GGNNCC	1 cut(s)	357
BmrFI	CCNGG	1 cut(s)	220
BmsI	GCATC	1 cut(s)	124
Bpu14I	TTCGAA	1 cut(s)	9
BsaAI	YACGTR	1 cut(s)	345
BsaJI	CCNNGG	4 cut(s)	139, 196, 219, 261
Bsc4I	CCNNNNNNNGG	2 cut(s)	144, 302
BseBI	CCWGG	1 cut(s)	220
BseDI	CCNNGG	4 cut(s)	139, 196, 219, 261
BseGI	GGATG	2 cut(s)	149, 206
BseLI	CCNNNNNNNGG	2 cut(s)	144, 302
BshNI	GGYRCC	1 cut(s)	355
BslFI	GGGAC	9 cut(s)	79, 84, 109, 114, 243, 304, 318, 319, 324
BslI	CCNNNNNNNGG	2 cut(s)	144, 302
BsmAI	GTCTC	2 cut(s)	79, 163
BsmBI	CGTCTC	2 cut(s)	79, 163
BsmFI	GGGAC	9 cut(s)	79, 84, 109, 114, 243, 304, 318, 319, 324
Bsp119I	TTCGAA	1 cut(s)	9
Bsp19I	CCATGG	1 cut(s)	261
BspACI	CCGC	1 cut(s)	123
BspLI	GGNNCC	1 cut(s)	357
BspT104I	TTCGAA	1 cut(s)	9
BspT107I	GGYRCC	1 cut(s)	355
BssECI	CCNNGG	4 cut(s)	139, 196, 219, 261
BssT1I	CCWWGG	1 cut(s)	261
Bst2UI	CCWGG	1 cut(s)	220
Bst4CI	ACNGT	1 cut(s)	355
BstBAI	YACGTR	1 cut(s)	345
BstBI	TTCGAA	1 cut(s)	9
BstDEI	CTNAG	2 cut(s)	40, 360
BstDSI	CCRYGG	2 cut(s)	196, 261
BstF5I	GGATG	2 cut(s)	149, 206
BstHHI	GCGC	1 cut(s)	293
BstMAI	GTCTC	2 cut(s)	79, 163
BstNI	CCWGG	1 cut(s)	220
BstSCI	CCNGG	1 cut(s)	218
BstXI	CCANNNNNNTGG	1 cut(s)	203
BtgI	CCRYGG	2 cut(s)	196, 261
BtsCI	GGATG	2 cut(s)	149, 206
CfoI	GCGC	1 cut(s)	293
Csp6I	GTAC	2 cut(s)	346, 356
CviAII	CATG	1 cut(s)	262
CviJI	RGCY	1 cut(s)	271
CviKI_1	RGCY	1 cut(s)	271
CviQI	GTAC	2 cut(s)	346, 356
DdeI	CTNAG	2 cut(s)	40, 360
Eco130I	CCWWGG	1 cut(s)	261
EcoRI	GAATTC	1 cut(s)	5
EcoRII	CCWGG	1 cut(s)	218
EcoT14I	CCWWGG	1 cut(s)	261
ErhI	CCWWGG	1 cut(s)	261
Esp3I	CGTCTC	2 cut(s)	79, 163
FaeI	CATG	1 cut(s)	265
FaiI	YATR	3 cut(s)	57, 183, 263
FalI	AAGNNNNNCTT	2 cut(s)	23, 55
FaqI	GGGAC	9 cut(s)	79, 84, 109, 114, 243, 304, 318, 319, 324
FatI	CATG	1 cut(s)	261
FauI	CCCGC	1 cut(s)	116
FokI	GGATG	2 cut(s)	156, 213
GlaI	GCGC	1 cut(s)	292
HhaI	GCGC	1 cut(s)	293
Hin1II	CATG	1 cut(s)	265
Hin6I	GCGC	1 cut(s)	291
HinP1I	GCGC	1 cut(s)	291
HinfI	GANTC	1 cut(s)	211
HphI	GGTGA	1 cut(s)	238
Hpy166II	GTNNAC	1 cut(s)	37
Hpy188I	TCNGA	1 cut(s)	143
Hpy8I	GTNNAC	1 cut(s)	37
HpyCH4III	ACNGT	1 cut(s)	355
HpyCH4IV	ACGT	2 cut(s)	300, 344
HpyCH4V	TGCA	1 cut(s)	59
HpyF3I	CTNAG	2 cut(s)	40, 360
HpySE526I	ACGT	2 cut(s)	300, 344
Hsp92II	CATG	1 cut(s)	265
HspAI	GCGC	1 cut(s)	291
KpnI	GGTACC	1 cut(s)	359
LmnI	GCTCC	1 cut(s)	126
LpnPI	CCDG	3 cut(s)	89, 205, 232
LweI	GCATC	1 cut(s)	124
MaeII	ACGT	2 cut(s)	300, 344
MboII	GAAGA	2 cut(s)	171, 174
MluCI	AATT	4 cut(s)	5, 11, 184, 241
MlyI	GAGTC	1 cut(s)	220
MnlI	CCTC	4 cut(s)	149, 149, 170, 222
MseI	TTAA	2 cut(s)	30, 287
MslI	CAYNNNNRTG	1 cut(s)	201
MspR9I	CCNGG	1 cut(s)	220
MvaI	CCWGG	1 cut(s)	220
NcoI	CCATGG	1 cut(s)	261
NlaIII	CATG	1 cut(s)	265
NlaIV	GGNNCC	1 cut(s)	357
NspV	TTCGAA	1 cut(s)	9
OliI	CACNNNNGTG	1 cut(s)	201
PcsI	WCGNNNNNNNCGW	1 cut(s)	279
PleI	GAGTC	1 cut(s)	219
PpsI	GAGTC	1 cut(s)	219
Ppu21I	YACGTR	1 cut(s)	345
PsiI	TTATAA	1 cut(s)	183
Psp6I	CCWGG	1 cut(s)	218
PspGI	CCWGG	1 cut(s)	218
PspN4I	GGNNCC	1 cut(s)	357
RsaI	GTAC	2 cut(s)	347, 357
RsaNI	GTAC	2 cut(s)	346, 356
RseI	CAYNNNNRTG	1 cut(s)	201
SaqAI	TTAA	2 cut(s)	30, 287
SchI	GAGTC	1 cut(s)	220
ScrFI	CCNGG	1 cut(s)	220
SetI	ASST	8 cut(s)	36, 46, 181, 233, 273, 303, 347, 361
SfaNI	GCATC	1 cut(s)	124
SfuI	TTCGAA	1 cut(s)	9
SmiMI	CAYNNNNRTG	1 cut(s)	201
Sse9I	AATT	4 cut(s)	5, 11, 184, 241
SsiI	CCGC	1 cut(s)	123
StyD4I	CCNGG	1 cut(s)	218
StyI	CCWWGG	1 cut(s)	261
TaaI	ACNGT	1 cut(s)	355
TaiI	ACGT	2 cut(s)	303, 347
TaqI	TCGA	1 cut(s)	9
TasI	AATT	4 cut(s)	5, 11, 184, 241
Tru1I	TTAA	2 cut(s)	30, 287
Tru9I	TTAA	2 cut(s)	30, 287
TspGWI	ACGGA	9 cut(s)	88, 93, 103, 123, 128, 187, 213, 321, 322
XapI	RAATTY	3 cut(s)	5, 11, 241

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.