Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr2

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Forward (+)

5737269 .. 5737559

Gene Structure 291 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom02g08200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

ATGGGATGGGACGGAACGGGACAGGACAGAACGGAACGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACAGAGAAGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGAGGTGAGGTGGAACGAAAATTCACCCAAAACTAGTCCCGTGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGATGGAACGCCTTGTCCCACTCTGTTCCGTCCCGTCCCACGTACAAAACGGTACTATTGAACGATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

97

Amino Acids

10.77

Weight (kDa)

10.54

Isoelectric Point (pI)

89.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	102
AccBSI	CCGCTC	1 cut(s)	42
AciI	CCGC	1 cut(s)	42
AcsI	RAATTY	1 cut(s)	160
AfaI	GTAC	2 cut(s)	266, 276
AfiI	CCNNNNNNNGG	3 cut(s)	63, 206, 221
AgsI	TTSAA	1 cut(s)	283
AhlI	ACTAGT	1 cut(s)	173
AjnI	CCWGG	1 cut(s)	137
AleI	CACNNNNGTG	1 cut(s)	120
AloI	GAACNNNNNNTCC	2 cut(s)	221, 253
AluBI	AGCT	1 cut(s)	190
AluI	AGCT	1 cut(s)	190
Alw26I	GTCTC	1 cut(s)	82
ApoI	RAATTY	1 cut(s)	160
AspLEI	GCGC	1 cut(s)	212
AsuHPI	GGTGA	2 cut(s)	156, 157
BccI	CCATC	2 cut(s)	57, 219
BciT130I	CCWGG	1 cut(s)	139
BcoDI	GTCTC	1 cut(s)	82
BcuI	ACTAGT	1 cut(s)	173
BfaI	CTAG	1 cut(s)	174
Bme1390I	CCNGG	1 cut(s)	139
BmrFI	CCNGG	1 cut(s)	139
BmsI	GCATC	1 cut(s)	43
BsaAI	YACGTR	1 cut(s)	264
BsaJI	CCNNGG	4 cut(s)	58, 115, 138, 180
BsaXI	ACNNNNNCTCC	2 cut(s)	134, 164
Bsc4I	CCNNNNNNNGG	3 cut(s)	63, 206, 221
BseBI	CCWGG	1 cut(s)	139
BseDI	CCNNGG	4 cut(s)	58, 115, 138, 180
BseGI	GGATG	4 cut(s)	11, 68, 125, 230
BseLI	CCNNNNNNNGG	3 cut(s)	63, 206, 221
BslFI	GGGAC	6 cut(s)	23, 33, 162, 223, 238, 243
BslI	CCNNNNNNNGG	3 cut(s)	63, 206, 221
BsmAI	GTCTC	1 cut(s)	82
BsmFI	GGGAC	6 cut(s)	23, 33, 162, 223, 238, 243
BspACI	CCGC	1 cut(s)	42
BsrBI	CCGCTC	1 cut(s)	42
BssECI	CCNNGG	4 cut(s)	58, 115, 138, 180
Bst2UI	CCWGG	1 cut(s)	139
Bst4CI	ACNGT	1 cut(s)	274
BstBAI	YACGTR	1 cut(s)	264
BstDSI	CCRYGG	2 cut(s)	115, 180
BstF5I	GGATG	4 cut(s)	11, 68, 125, 230
BstHHI	GCGC	1 cut(s)	212
BstMAI	GTCTC	1 cut(s)	82
BstNI	CCWGG	1 cut(s)	139
BstSCI	CCNGG	1 cut(s)	137
BstXI	CCANNNNNNTGG	1 cut(s)	122
BtgI	CCRYGG	2 cut(s)	115, 180
BtsCI	GGATG	4 cut(s)	11, 68, 125, 230
CfoI	GCGC	1 cut(s)	212
Csp6I	GTAC	2 cut(s)	265, 275
CviJI	RGCY	1 cut(s)	190
CviKI_1	RGCY	1 cut(s)	190
CviQI	GTAC	2 cut(s)	265, 275
EcoRII	CCWGG	1 cut(s)	137
FaiI	YATR	1 cut(s)	102
FaqI	GGGAC	6 cut(s)	23, 33, 162, 223, 238, 243
FauI	CCCGC	1 cut(s)	35
FokI	GGATG	4 cut(s)	18, 75, 132, 237
FspBI	CTAG	1 cut(s)	174
GlaI	GCGC	1 cut(s)	211
HhaI	GCGC	1 cut(s)	212
Hin6I	GCGC	1 cut(s)	210
HinP1I	GCGC	1 cut(s)	210
HinfI	GANTC	1 cut(s)	130
HphI	GGTGA	2 cut(s)	156, 157
Hpy188I	TCNGA	1 cut(s)	62
HpyAV	CCTTC	1 cut(s)	78
HpyCH4III	ACNGT	1 cut(s)	274
HpyCH4IV	ACGT	2 cut(s)	219, 263
HpySE526I	ACGT	2 cut(s)	219, 263
HspAI	GCGC	1 cut(s)	210
LmnI	GCTCC	2 cut(s)	39, 45
LpnPI	CCDG	3 cut(s)	8, 124, 151
LweI	GCATC	1 cut(s)	43
MaeI	CTAG	1 cut(s)	174
MaeII	ACGT	2 cut(s)	219, 263
MbiI	CCGCTC	1 cut(s)	42
MboII	GAAGA	2 cut(s)	90, 93
MluCI	AATT	2 cut(s)	103, 160
MlyI	GAGTC	1 cut(s)	139
MnlI	CCTC	4 cut(s)	68, 68, 136, 141
MseI	TTAA	1 cut(s)	289
MslI	CAYNNNNRTG	1 cut(s)	120
MspR9I	CCNGG	1 cut(s)	139
MvaI	CCWGG	1 cut(s)	139
OliI	CACNNNNGTG	1 cut(s)	120
PcsI	WCGNNNNNNNCGW	1 cut(s)	198
PleI	GAGTC	1 cut(s)	138
PpsI	GAGTC	1 cut(s)	138
Ppu21I	YACGTR	1 cut(s)	264
PsiI	TTATAA	1 cut(s)	102
Psp6I	CCWGG	1 cut(s)	137
PspGI	CCWGG	1 cut(s)	137
RsaI	GTAC	2 cut(s)	266, 276
RsaNI	GTAC	2 cut(s)	265, 275
RseI	CAYNNNNRTG	1 cut(s)	120
SaqAI	TTAA	1 cut(s)	289
SchI	GAGTC	1 cut(s)	139
ScrFI	CCNGG	1 cut(s)	139
SetI	ASST	5 cut(s)	147, 152, 192, 222, 266
SfaNI	GCATC	1 cut(s)	43
SmiMI	CAYNNNNRTG	1 cut(s)	120
SpeI	ACTAGT	1 cut(s)	173
Sse9I	AATT	2 cut(s)	103, 160
SsiI	CCGC	1 cut(s)	42
SspMI	CTAG	1 cut(s)	174
StyD4I	CCNGG	1 cut(s)	137
TaaI	ACNGT	1 cut(s)	274
TaiI	ACGT	2 cut(s)	222, 266
TasI	AATT	2 cut(s)	103, 160
Tru1I	TTAA	1 cut(s)	289
Tru9I	TTAA	1 cut(s)	289
TspGWI	ACGGA	5 cut(s)	27, 47, 52, 132, 240
XapI	RAATTY	1 cut(s)	160
XcmI	CCANNNNNNNNNTGG	1 cut(s)	222
XspI	CTAG	1 cut(s)	174

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.