Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr7

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

7720177 .. 7720664

Gene Structure 488 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom07g08310.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 396 bp

ATGTGGATCGATGGACAAACAAAAAAACTGATCTTGCTAGGTGCAATGCAAGTATCTCGGTGCAGCGTTTCCTTAGGTATCGTTTGGTATGCAGACGGGACGGGACGGAACGGAATGGGACGGGACGGGACGGGACAGGACGGAACGGAACGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAAGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCACCCAAAACTCGTCCCGTGGAACAGCTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACGCTTTGTCCCACTCTGTTCCGTCCCGTTCCGCGTACCAAACGGTACCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

132

Amino Acids

14.41

Weight (kDa)

11.39

Isoelectric Point (pI)

66.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	216
Acc65I	GGTACC	1 cut(s)	388
AccB1I	GGYRCC	1 cut(s)	388
AccBSI	CCGCTC	1 cut(s)	156
AccII	CGCG	1 cut(s)	377
AciI	CCGC	2 cut(s)	156, 375
AclWI	GGATC	1 cut(s)	14
AcsI	RAATTY	1 cut(s)	274
AfaI	GTAC	2 cut(s)	380, 390
AfiI	CCNNNNNNNGG	3 cut(s)	177, 320, 335
AjnI	CCWGG	1 cut(s)	251
AleI	CACNNNNGTG	1 cut(s)	234
AloI	GAACNNNNNNTCC	2 cut(s)	335, 367
AluBI	AGCT	1 cut(s)	304
AluI	AGCT	1 cut(s)	304
Alw26I	GTCTC	1 cut(s)	196
AlwI	GGATC	1 cut(s)	14
ApeKI	GCWGC	1 cut(s)	63
ApoI	RAATTY	1 cut(s)	274
Asp718I	GGTACC	1 cut(s)	388
AspLEI	GCGC	1 cut(s)	326
AsuHPI	GGTGA	2 cut(s)	270, 271
AxyI	CCTNAGG	1 cut(s)	73
BanI	GGYRCC	1 cut(s)	388
BbvI	GCAGC	1 cut(s)	75
BccI	CCATC	2 cut(s)	5, 171
BcgI	CGANNNNNNTGC	2 cut(s)	38, 72
BciT130I	CCWGG	1 cut(s)	253
BcoDI	GTCTC	1 cut(s)	196
BfaI	CTAG	1 cut(s)	38
BisI	GCNGC	1 cut(s)	64
BlsI	GCNGC	1 cut(s)	65
Bme1390I	CCNGG	1 cut(s)	253
BmiI	GGNNCC	1 cut(s)	390
BmrFI	CCNGG	1 cut(s)	253
BmsI	GCATC	1 cut(s)	157
Bsa29I	ATCGAT	1 cut(s)	9
BsaJI	CCNNGG	4 cut(s)	172, 229, 252, 294
Bsc4I	CCNNNNNNNGG	3 cut(s)	177, 320, 335
Bse21I	CCTNAGG	1 cut(s)	73
Bse3DI	GCAATG	1 cut(s)	51
BseBI	CCWGG	1 cut(s)	253
BseCI	ATCGAT	1 cut(s)	9
BseDI	CCNNGG	4 cut(s)	172, 229, 252, 294
BseGI	GGATG	2 cut(s)	182, 239
BseLI	CCNNNNNNNGG	3 cut(s)	177, 320, 335
BseMI	GCAATG	1 cut(s)	51
BseXI	GCAGC	1 cut(s)	75
BsgI	GTGCAG	1 cut(s)	82
Bsh1236I	CGCG	1 cut(s)	377
BshNI	GGYRCC	1 cut(s)	388
BshVI	ATCGAT	1 cut(s)	9
BslI	CCNNNNNNNGG	3 cut(s)	177, 320, 335
BsmAI	GTCTC	1 cut(s)	196
BsmBI	CGTCTC	1 cut(s)	196
Bsp143I	GATC	2 cut(s)	6, 30
BspACI	CCGC	2 cut(s)	156, 375
BspDI	ATCGAT	1 cut(s)	9
BspFNI	CGCG	1 cut(s)	377
BspLI	GGNNCC	1 cut(s)	390
BspPI	GGATC	1 cut(s)	14
BspT107I	GGYRCC	1 cut(s)	388
BsrBI	CCGCTC	1 cut(s)	156
BsrDI	GCAATG	1 cut(s)	51
BssECI	CCNNGG	4 cut(s)	172, 229, 252, 294
BssMI	GATC	2 cut(s)	6, 30
Bst2UI	CCWGG	1 cut(s)	253
Bst4CI	ACNGT	1 cut(s)	388
BstDEI	CTNAG	1 cut(s)	73
BstDSI	CCRYGG	2 cut(s)	229, 294
BstF5I	GGATG	2 cut(s)	182, 239
BstFNI	CGCG	1 cut(s)	377
BstHHI	GCGC	1 cut(s)	326
BstKTI	GATC	2 cut(s)	9, 33
BstMAI	GTCTC	1 cut(s)	196
BstMBI	GATC	2 cut(s)	6, 30
BstNI	CCWGG	1 cut(s)	253
BstSCI	CCNGG	1 cut(s)	251
BstUI	CGCG	1 cut(s)	377
BstV1I	GCAGC	1 cut(s)	75
BstXI	CCANNNNNNTGG	1 cut(s)	236
Bsu15I	ATCGAT	1 cut(s)	9
Bsu36I	CCTNAGG	1 cut(s)	73
BsuTUI	ATCGAT	1 cut(s)	9
BtgI	CCRYGG	2 cut(s)	229, 294
BtsCI	GGATG	2 cut(s)	182, 239
CfoI	GCGC	1 cut(s)	326
ClaI	ATCGAT	1 cut(s)	9
Csp6I	GTAC	2 cut(s)	379, 389
CviJI	RGCY	1 cut(s)	304
CviKI_1	RGCY	1 cut(s)	304
CviQI	GTAC	2 cut(s)	379, 389
DdeI	CTNAG	1 cut(s)	73
DpnI	GATC	2 cut(s)	8, 32
DpnII	GATC	2 cut(s)	6, 30
Eco81I	CCTNAGG	1 cut(s)	73
EcoRII	CCWGG	1 cut(s)	251
Esp3I	CGTCTC	1 cut(s)	196
FaiI	YATR	2 cut(s)	90, 216
FauI	CCCGC	1 cut(s)	149
Fnu4HI	GCNGC	1 cut(s)	64
FokI	GGATG	2 cut(s)	189, 246
Fsp4HI	GCNGC	1 cut(s)	64
FspBI	CTAG	1 cut(s)	38
GlaI	GCGC	1 cut(s)	325
GluI	GCNGC	1 cut(s)	64
HhaI	GCGC	1 cut(s)	326
Hin6I	GCGC	1 cut(s)	324
HinP1I	GCGC	1 cut(s)	324
HinfI	GANTC	1 cut(s)	244
HphI	GGTGA	2 cut(s)	270, 271
Hpy188I	TCNGA	1 cut(s)	176
HpyAV	CCTTC	1 cut(s)	192
HpyCH4III	ACNGT	1 cut(s)	388
HpyCH4IV	ACGT	1 cut(s)	333
HpyCH4V	TGCA	4 cut(s)	44, 49, 63, 92
HpyF3I	CTNAG	1 cut(s)	73
HpySE526I	ACGT	1 cut(s)	333
HspAI	GCGC	1 cut(s)	324
KpnI	GGTACC	1 cut(s)	392
Kzo9I	GATC	2 cut(s)	6, 30
LmnI	GCTCC	2 cut(s)	153, 159
LpnPI	CCDG	3 cut(s)	122, 238, 265
Lsp1109I	GCAGC	1 cut(s)	75
LweI	GCATC	1 cut(s)	157
MaeI	CTAG	1 cut(s)	38
MaeII	ACGT	1 cut(s)	333
MalI	GATC	2 cut(s)	8, 32
MbiI	CCGCTC	1 cut(s)	156
MboI	GATC	2 cut(s)	6, 30
MboII	GAAGA	2 cut(s)	204, 207
MluCI	AATT	2 cut(s)	217, 274
MlyI	GAGTC	1 cut(s)	253
MnlI	CCTC	4 cut(s)	182, 182, 203, 255
MseI	TTAA	1 cut(s)	394
MslI	CAYNNNNRTG	1 cut(s)	234
MspR9I	CCNGG	1 cut(s)	253
MvaI	CCWGG	1 cut(s)	253
MvnI	CGCG	1 cut(s)	377
NdeII	GATC	2 cut(s)	6, 30
NlaIV	GGNNCC	1 cut(s)	390
OliI	CACNNNNGTG	1 cut(s)	234
PcsI	WCGNNNNNNNCGW	1 cut(s)	312
PkrI	GCNGC	1 cut(s)	65
PleI	GAGTC	1 cut(s)	252
PpsI	GAGTC	1 cut(s)	252
PsiI	TTATAA	1 cut(s)	216
Psp6I	CCWGG	1 cut(s)	251
PspGI	CCWGG	1 cut(s)	251
PspN4I	GGNNCC	1 cut(s)	390
RsaI	GTAC	2 cut(s)	380, 390
RsaNI	GTAC	2 cut(s)	379, 389
RseI	CAYNNNNRTG	1 cut(s)	234
SaqAI	TTAA	1 cut(s)	394
SatI	GCNGC	1 cut(s)	64
Sau3AI	GATC	2 cut(s)	6, 30
SchI	GAGTC	1 cut(s)	253
ScrFI	CCNGG	1 cut(s)	253
SetI	ASST	7 cut(s)	43, 79, 214, 266, 306, 336, 394
SfaNI	GCATC	1 cut(s)	157
SmiMI	CAYNNNNRTG	1 cut(s)	234
Sse9I	AATT	2 cut(s)	217, 274
SsiI	CCGC	2 cut(s)	156, 375
SspMI	CTAG	1 cut(s)	38
StyD4I	CCNGG	1 cut(s)	251
TaaI	ACNGT	1 cut(s)	388
TaiI	ACGT	1 cut(s)	336
TaqI	TCGA	1 cut(s)	9
TasI	AATT	2 cut(s)	217, 274
Tru1I	TTAA	1 cut(s)	394
Tru9I	TTAA	1 cut(s)	394
TseI	GCWGC	1 cut(s)	63
TspGWI	ACGGA	9 cut(s)	121, 126, 156, 161, 166, 220, 246, 354, 355
XapI	RAATTY	1 cut(s)	274
XspI	CTAG	1 cut(s)	38

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.