pycom04g10710

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0001392
Physical Location & Seq
Reverse (-)
13458157 .. 13462410
4254 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g10710.1

Sequence Viewer

Length: 204 bp
ATGTTTGATTTGAGTTGTTTGCATGTTTTATTTTACTTGAATTCGAGTATCCAACTAGAAGAAAGAGAAAGATCTGAATGGGAGCAAGGCAGAACATGGAACAAACGAGTGCATGAGAATTTTATGTTCAGGGGATTTGGGGAAAGGGTGACCAATCATTTGAATAAACTCAGGAAAGAAACGTTGCTGACTGTGTACCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.25

Weight (kDa)

7.97

Isoelectric Point (pI)

45.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 182
AcsI RAATTY 2 cut(s) 40, 118
AfaI GTAC 1 cut(s) 197
AgsI TTSAA 2 cut(s) 40, 163
ApoI RAATTY 2 cut(s) 40, 118
ArsI GACNNNNNNTTYG 2 cut(s) 142, 174
AsuHPI GGTGA 1 cut(s) 160
BciVI GTATCC 1 cut(s) 59
BfaI CTAG 1 cut(s) 56
BfuI GTATCC 1 cut(s) 59
BglII AGATCT 1 cut(s) 71
BseMII CTCAG 1 cut(s) 184
Bsp143I GATC 1 cut(s) 71
BspCNI CTCAG 1 cut(s) 183
BssMI GATC 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 193
BstDEI CTNAG 1 cut(s) 170
BstEII GGTNACC 1 cut(s) 148
BstKTI GATC 1 cut(s) 74
BstMBI GATC 1 cut(s) 71
BstNSI RCATGY 1 cut(s) 26
BstPI GGTNACC 1 cut(s) 148
BstX2I RGATCY 1 cut(s) 71
BstYI RGATCY 1 cut(s) 71
BsuI GTATCC 1 cut(s) 59
Csp6I GTAC 1 cut(s) 196
CviAII CATG 3 cut(s) 23, 96, 113
CviQI GTAC 1 cut(s) 196
DdeI CTNAG 1 cut(s) 170
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
Eco91I GGTNACC 1 cut(s) 148
EcoO65I GGTNACC 1 cut(s) 148
EcoRI GAATTC 1 cut(s) 40
FaeI CATG 3 cut(s) 26, 99, 116
FaiI YATR 4 cut(s) 24, 97, 114, 125
FatI CATG 3 cut(s) 22, 95, 112
FspBI CTAG 1 cut(s) 56
Hin1II CATG 3 cut(s) 26, 99, 116
HphI GGTGA 1 cut(s) 160
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 172
Hpy8I GTNNAC 1 cut(s) 196
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4IV ACGT 1 cut(s) 182
HpyCH4V TGCA 2 cut(s) 22, 112
HpyF3I CTNAG 1 cut(s) 170
HpySE526I ACGT 1 cut(s) 182
Hsp92II CATG 3 cut(s) 26, 99, 116
Kzo9I GATC 1 cut(s) 71
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 2 cut(s) 115, 157
MaeI CTAG 1 cut(s) 56
MaeII ACGT 1 cut(s) 182
MaeIII GTNAC 1 cut(s) 148
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MboII GAAGA 1 cut(s) 71
MflI RGATCY 1 cut(s) 71
MluCI AATT 2 cut(s) 40, 118
MmeI TCCRAC 1 cut(s) 76
NdeII GATC 1 cut(s) 71
NlaIII CATG 3 cut(s) 26, 99, 116
NmuCI GTSAC 1 cut(s) 148
NspI RCATGY 1 cut(s) 26
Psp1406I AACGTT 1 cut(s) 182
PspEI GGTNACC 1 cut(s) 148
PsuI RGATCY 1 cut(s) 71
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
Sau3AI GATC 1 cut(s) 71
SetI ASST 2 cut(s) 185, 201
Sse9I AATT 2 cut(s) 40, 118
SspMI CTAG 1 cut(s) 56
TaaI ACNGT 1 cut(s) 193
TaiI ACGT 1 cut(s) 185
TaqI TCGA 1 cut(s) 44
TasI AATT 2 cut(s) 40, 118
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
XapI RAATTY 2 cut(s) 40, 118
XceI RCATGY 1 cut(s) 26
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.