Rh6AG212400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
37863828 .. 37902301
38474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG212400.1

Sequence Viewer

Length: 267 bp
ATGTCGGCGTTCGAGCCGTTCTGGATGCCTGCGCCTGCCCTAACCTCTTCTTGCTTTTATCTCATCCTGAAGACAAGATCACCCAAAGCCAAGAGCACTAGCAATAGCAGGGGAGAGGAAGCAGATCAAGAGCAATATGACCAGCTTTGCATTGTTCTTGTTAATCTGCTTCCTGGTTCTGAGATTACTCAAGGAGGAGAAACCAAAAGCTGGGAGCAAGAACAGACATGGATGAAACAAGTTGAAAGGGAATCTCAGCATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.07

Weight (kDa)

4.87

Isoelectric Point (pI)

82.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 210
AcuI CTGAAG 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 210
AgsI TTSAA 1 cut(s) 245
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 2 cut(s) 145, 210
AluI AGCT 2 cut(s) 145, 210
Alw21I GWGCWC 1 cut(s) 98
AspLEI GCGC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 72
BbsI GAAGAC 1 cut(s) 77
Bbv12I GWGCWC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 174
BfaI CTAG 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 1 cut(s) 15
BpiI GAAGAC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 210
BseBI CCWGG 1 cut(s) 174
BseGI GGATG 3 cut(s) 30, 63, 237
BseLI CCNNNNNNNGG 1 cut(s) 210
BseMII CTCAG 1 cut(s) 171
BseRI GAGGAG 1 cut(s) 210
BseYI CCCAGC 1 cut(s) 210
BsiHKAI GWGCWC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 210
Bsp1286I GDGCHC 1 cut(s) 98
Bsp143I GATC 2 cut(s) 77, 124
BspCNI CTCAG 1 cut(s) 172
BssMI GATC 2 cut(s) 77, 124
Bst2UI CCWGG 1 cut(s) 174
Bst6I CTCTTC 1 cut(s) 52
BstC8I GCNNGC 2 cut(s) 30, 36
BstDEI CTNAG 2 cut(s) 180, 255
BstF5I GGATG 3 cut(s) 30, 63, 237
BstHHI GCGC 1 cut(s) 34
BstKTI GATC 2 cut(s) 80, 127
BstMBI GATC 2 cut(s) 77, 124
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BstV2I GAAGAC 1 cut(s) 77
BtsCI GGATG 3 cut(s) 30, 63, 237
Cac8I GCNNGC 2 cut(s) 30, 36
CfoI GCGC 1 cut(s) 34
CviAII CATG 1 cut(s) 228
CviJI RGCY 4 cut(s) 16, 89, 145, 210
CviKI_1 RGCY 4 cut(s) 16, 89, 145, 210
DdeI CTNAG 2 cut(s) 180, 255
DpnI GATC 2 cut(s) 79, 126
DpnII GATC 2 cut(s) 77, 124
Eam1104I CTCTTC 1 cut(s) 52
EarI CTCTTC 1 cut(s) 52
Eco57I CTGAAG 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 172
FaeI CATG 1 cut(s) 231
FaiI YATR 4 cut(s) 138, 229, 261, 263
FatI CATG 1 cut(s) 227
FauNDI CATATG 1 cut(s) 261
FokI GGATG 3 cut(s) 37, 50, 244
FspBI CTAG 1 cut(s) 99
GlaI GCGC 1 cut(s) 33
GsaI CCCAGC 1 cut(s) 214
HhaI GCGC 1 cut(s) 34
Hin1II CATG 1 cut(s) 231
Hin6I GCGC 1 cut(s) 32
HinP1I GCGC 1 cut(s) 32
HinfI GANTC 1 cut(s) 251
HphI GGTGA 1 cut(s) 72
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 3 cut(s) 22, 67, 128
HpyCH4V TGCA 1 cut(s) 150
HpyF3I CTNAG 2 cut(s) 180, 255
Hsp92II CATG 1 cut(s) 231
HspAI GCGC 1 cut(s) 32
Kzo9I GATC 2 cut(s) 77, 124
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 9 cut(s) 7, 42, 48, 80, 94, 155, 159, 186, 196
LweI GCATC 1 cut(s) 15
MaeI CTAG 1 cut(s) 99
MalI GATC 2 cut(s) 79, 126
MboI GATC 2 cut(s) 77, 124
MboII GAAGA 2 cut(s) 39, 82
MhlI GDGCHC 1 cut(s) 98
MnlI CCTC 3 cut(s) 55, 109, 188
MseI TTAA 1 cut(s) 162
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NdeI CATATG 1 cut(s) 261
NdeII GATC 2 cut(s) 77, 124
NlaIII CATG 1 cut(s) 231
PfeI GAWTC 1 cut(s) 251
PflMI CCANNNNNTGG 1 cut(s) 210
Psp6I CCWGG 1 cut(s) 172
PspFI CCCAGC 1 cut(s) 210
PspGI CCWGG 1 cut(s) 172
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 2 cut(s) 77, 124
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 98
SetI ASST 3 cut(s) 47, 147, 212
SfaNI GCATC 1 cut(s) 15
SmlI CTYRAG 1 cut(s) 189
SmoI CTYRAG 1 cut(s) 189
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 172
TaqI TCGA 1 cut(s) 12
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 248
Van91I CCANNNNNTGG 1 cut(s) 210
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.