Rh4BG046300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
8379456 .. 8387371
7916 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG046300.1

Sequence Viewer

Length: 210 bp
ATGGAACAATGCGATACCAATAAGGTAGTCCCAATGAATTCCAAACGAAAGAATGACAAGGGCCCACAACACGCTCTCGCCATGGGCCCTGATACAATACCAAATGTCCTCAAGAAGGTAACGGGAGAGAGAGAATTTTGGATTTCTCAATTTTCCGTTTGCGTTTCCAGCTTCATTTGCACAATGAACGACCTCCTCAAGGTATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.74

Weight (kDa)

8.55

Isoelectric Point (pI)

14.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 37, 134
AfiI CCNNNNNNNGG 2 cut(s) 115, 199
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
AoxI GGCC 2 cut(s) 61, 85
ApaI GGGCCC 2 cut(s) 65, 89
ApoI RAATTY 2 cut(s) 37, 134
AspS9I GGNCC 4 cut(s) 61, 62, 85, 86
BaeGI GKGCMC 2 cut(s) 65, 89
BanII GRGCYC 2 cut(s) 65, 89
BmgT120I GGNCC 4 cut(s) 61, 62, 85, 86
BmiI GGNNCC 2 cut(s) 63, 87
BpuEI CTTGAG 2 cut(s) 95, 182
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 2 cut(s) 115, 199
BseDI CCNNGG 1 cut(s) 81
BseLI CCNNNNNNNGG 2 cut(s) 115, 199
BseRI GAGGAG 1 cut(s) 185
BseSI GKGCMC 2 cut(s) 65, 89
BshFI GGCC 2 cut(s) 63, 87
BslFI GGGAC 1 cut(s) 14
BslI CCNNNNNNNGG 2 cut(s) 115, 199
BsmFI GGGAC 1 cut(s) 14
BsnI GGCC 2 cut(s) 63, 87
Bsp120I GGGCCC 2 cut(s) 61, 85
Bsp1286I GDGCHC 2 cut(s) 65, 89
Bsp19I CCATGG 1 cut(s) 81
BspANI GGCC 2 cut(s) 63, 87
BspLI GGNNCC 2 cut(s) 63, 87
BssECI CCNNGG 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 81
BstDSI CCRYGG 1 cut(s) 81
BstENI CCTNNNNNAGG 2 cut(s) 113, 197
BstMWI GCNNNNNNNGC 2 cut(s) 168, 177
BstSLI GKGCMC 2 cut(s) 65, 89
BsuRI GGCC 2 cut(s) 63, 87
BtgI CCRYGG 1 cut(s) 81
Cfr13I GGNCC 4 cut(s) 61, 62, 85, 86
CviAII CATG 1 cut(s) 82
CviJI RGCY 3 cut(s) 63, 87, 171
CviKI_1 RGCY 3 cut(s) 63, 87, 171
Eco130I CCWWGG 1 cut(s) 81
Eco24I GRGCYC 2 cut(s) 65, 89
EcoNI CCTNNNNNAGG 2 cut(s) 113, 197
EcoO109I RGGNCCY 2 cut(s) 61, 86
EcoRI GAATTC 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 81
EcoT38I GRGCYC 2 cut(s) 65, 89
ErhI CCWWGG 1 cut(s) 81
FaeI CATG 1 cut(s) 85
FaiI YATR 1 cut(s) 83
FaqI GGGAC 1 cut(s) 14
FatI CATG 1 cut(s) 81
FriOI GRGCYC 2 cut(s) 65, 89
HaeIII GGCC 2 cut(s) 63, 87
Hin1II CATG 1 cut(s) 85
Hpy188III TCNNGA 2 cut(s) 112, 207
HpyAV CCTTC 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 180
HpyF10VI GCNNNNNNNGC 2 cut(s) 168, 177
Hsp92II CATG 1 cut(s) 85
LpnPI CCDG 2 cut(s) 102, 181
MaeIII GTNAC 1 cut(s) 118
MhlI GDGCHC 2 cut(s) 65, 89
MluCI AATT 3 cut(s) 37, 134, 149
MnlI CCTC 3 cut(s) 119, 203, 206
MwoI GCNNNNNNNGC 2 cut(s) 168, 177
NcoI CCATGG 1 cut(s) 81
NlaIII CATG 1 cut(s) 85
NlaIV GGNNCC 2 cut(s) 63, 87
PspN4I GGNNCC 2 cut(s) 63, 87
PspOMI GGGCCC 2 cut(s) 61, 85
PspPI GGNCC 4 cut(s) 61, 62, 85, 86
Sau96I GGNCC 4 cut(s) 61, 62, 85, 86
SduI GDGCHC 2 cut(s) 65, 89
SetI ASST 5 cut(s) 27, 120, 173, 195, 204
SgeI CNNG 8 cut(s) 70, 83, 89, 94, 101, 124, 135, 180
SmlI CTYRAG 2 cut(s) 110, 197
SmoI CTYRAG 2 cut(s) 110, 197
Sse9I AATT 3 cut(s) 37, 134, 149
StyI CCWWGG 1 cut(s) 81
TasI AATT 3 cut(s) 37, 134, 149
TspDTI ATGAA 3 cut(s) 50, 163, 200
TspGWI ACGGA 1 cut(s) 145
XagI CCTNNNNNAGG 2 cut(s) 113, 197
XapI RAATTY 2 cut(s) 37, 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.