pycom05g07810
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
10633842 .. 10634129
288 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g07810.1

Sequence Viewer

Length: 228 bp
ATGATTTTGGGTCAGGTCATATTACCCGTTTACTTTAACGGGTATTACACGACACGACCCGTTAAGCTATCGGGTATGACACGAAAACGACACGAAAACGAGAAACACAACACAAGTGCCAGGTTTATGTGCCTGATTTATTTATTTATTTATGAGAAATACCTAGAAATAGGACAATTTCTTAATCTTGGGACAAAATATGACATTTCGAATATGCACACCAATTAG

Protein Analysis

76

Amino Acids

8.93

Weight (kDa)

9.37

Isoelectric Point (pI)

37.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AsuII TTCGAA 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 121
Bpu14I TTCGAA 1 cut(s) 209
BseBI CCWGG 1 cut(s) 121
BslFI GGGAC 1 cut(s) 205
BsmFI GGGAC 1 cut(s) 205
Bsp119I TTCGAA 1 cut(s) 209
BspT104I TTCGAA 1 cut(s) 209
Bst2UI CCWGG 1 cut(s) 121
BstBI TTCGAA 1 cut(s) 209
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 119
FaiI YATR 6 cut(s) 20, 77, 128, 153, 201, 215
FaqI GGGAC 1 cut(s) 205
FspBI CTAG 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 217
LpnPI CCDG 3 cut(s) 106, 133, 146
MaeI CTAG 1 cut(s) 164
MluCI AATT 2 cut(s) 176, 223
MseI TTAA 3 cut(s) 36, 63, 183
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
NspV TTCGAA 1 cut(s) 209
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
SaqAI TTAA 3 cut(s) 36, 63, 183
ScrFI CCNGG 1 cut(s) 121
SetI ASST 4 cut(s) 18, 69, 125, 165
SfuI TTCGAA 1 cut(s) 209
Sse9I AATT 2 cut(s) 176, 223
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 209
TasI AATT 2 cut(s) 176, 223
Tru1I TTAA 3 cut(s) 36, 63, 183
Tru9I TTAA 3 cut(s) 36, 63, 183
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.