Rh6CG155300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
20152811 .. 20153485
675 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG155300.1

Sequence Viewer

Length: 291 bp
ATGGTAGAGAGCTTCGGACTAATGAAAGAAGATAAGGTTTCTAGCTTAGCTTATCACCATGGATATGCCAAAGGTCCTGTTAGTCTTGTAGCTGCAGCTGGTCGGCCCTTGGAAAATGGCAACGGCATGATTATGAAGAAACAGATCACTATTAGTGTTAGTTTCAGTGCGAACACGAATGCGGCAGCCGTGGCTTTACCTCTCTTAAAACAGCAAGATAGAGGCGATGTGCCACCTCATGGCGGCAACCGATGCACTAATCTCCCCAAACCCGGAAACCGCCATTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.17

Weight (kDa)

9.56

Isoelectric Point (pI)

28.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 239
AciI CCGC 3 cut(s) 182, 243, 280
AfiI CCNNNNNNNGG 3 cut(s) 239, 242, 272
AluBI AGCT 5 cut(s) 12, 45, 50, 92, 98
AluI AGCT 5 cut(s) 12, 45, 50, 92, 98
AoxI GGCC 1 cut(s) 104
ApeKI GCWGC 3 cut(s) 92, 95, 185
AspS9I GGNCC 2 cut(s) 74, 105
AsuC2I CCSGG 1 cut(s) 273
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 74
BbvI GCAGC 3 cut(s) 79, 107, 197
BceAI ACGGC 2 cut(s) 139, 173
BcnI CCSGG 1 cut(s) 273
BfaI CTAG 2 cut(s) 42, 289
BfmI CTRYAG 1 cut(s) 93
BisI GCNGC 5 cut(s) 93, 96, 183, 186, 244
BlpI GCTNAGC 1 cut(s) 46
BlsI GCNGC 5 cut(s) 94, 97, 184, 187, 245
Bme1390I CCNGG 1 cut(s) 273
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 2 cut(s) 74, 105
BmrFI CCNGG 1 cut(s) 273
BmsI GCATC 1 cut(s) 242
Bpu1102I GCTNAGC 1 cut(s) 46
BpuMI CCSGG 1 cut(s) 273
BsaJI CCNNGG 3 cut(s) 58, 108, 189
Bsc4I CCNNNNNNNGG 3 cut(s) 239, 242, 272
Bse3DI GCAATG 1 cut(s) 283
BseDI CCNNGG 3 cut(s) 58, 108, 189
BseLI CCNNNNNNNGG 3 cut(s) 239, 242, 272
BseMI GCAATG 1 cut(s) 283
BseXI GCAGC 3 cut(s) 79, 107, 197
BshFI GGCC 1 cut(s) 106
BsiSI CCGG 1 cut(s) 273
BslI CCNNNNNNNGG 3 cut(s) 239, 242, 272
BsmI GAATGC 1 cut(s) 184
BsnI GGCC 1 cut(s) 106
Bsp143I GATC 1 cut(s) 144
Bsp1720I GCTNAGC 1 cut(s) 46
Bsp19I CCATGG 1 cut(s) 58
BspACI CCGC 3 cut(s) 182, 243, 280
BspANI GGCC 1 cut(s) 106
BspMAI CTGCAG 1 cut(s) 97
BsrDI GCAATG 1 cut(s) 283
BssECI CCNNGG 3 cut(s) 58, 108, 189
BssMI GATC 1 cut(s) 144
BssT1I CCWWGG 2 cut(s) 58, 108
BstAPI GCANNNNNTGC 1 cut(s) 252
BstDEI CTNAG 1 cut(s) 46
BstDSI CCRYGG 2 cut(s) 58, 189
BstKTI GATC 1 cut(s) 147
BstMBI GATC 1 cut(s) 144
BstMWI GCNNNNNNNGC 2 cut(s) 191, 252
BstSCI CCNGG 1 cut(s) 271
BstSFI CTRYAG 1 cut(s) 93
BstV1I GCAGC 3 cut(s) 79, 107, 197
BsuRI GGCC 1 cut(s) 106
BtgI CCRYGG 2 cut(s) 58, 189
BtgZI GCGATG 1 cut(s) 240
BtsIMutI CAGTG 1 cut(s) 172
Cfr13I GGNCC 2 cut(s) 74, 105
CviAII CATG 3 cut(s) 59, 127, 239
CviJI RGCY 8 cut(s) 12, 45, 50, 92, 98, 106, 188, 194
CviKI_1 RGCY 8 cut(s) 12, 45, 50, 92, 98, 106, 188, 194
DdeI CTNAG 1 cut(s) 46
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
Eco130I CCWWGG 2 cut(s) 58, 108
Eco47I GGWCC 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 74
EcoT14I CCWWGG 2 cut(s) 58, 108
ErhI CCWWGG 2 cut(s) 58, 108
FaeI CATG 3 cut(s) 62, 130, 242
FaiI YATR 5 cut(s) 60, 66, 128, 134, 240
FatI CATG 3 cut(s) 58, 126, 238
Fnu4HI GCNGC 5 cut(s) 93, 96, 183, 186, 244
Fsp4HI GCNGC 5 cut(s) 93, 96, 183, 186, 244
FspBI CTAG 2 cut(s) 42, 289
GluI GCNGC 5 cut(s) 93, 96, 183, 186, 244
HaeIII GGCC 1 cut(s) 106
HapII CCGG 1 cut(s) 273
Hin1II CATG 3 cut(s) 62, 130, 242
HpaII CCGG 1 cut(s) 273
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 95, 255
HpyF10VI GCNNNNNNNGC 2 cut(s) 191, 252
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 3 cut(s) 62, 130, 242
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 3 cut(s) 84, 90, 286
Lsp1109I GCAGC 3 cut(s) 79, 107, 197
LweI GCATC 1 cut(s) 242
MaeI CTAG 2 cut(s) 42, 289
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MboII GAAGA 2 cut(s) 41, 148
MnlI CCTC 3 cut(s) 210, 215, 246
MseI TTAA 1 cut(s) 206
MslI CAYNNNNRTG 2 cut(s) 63, 131
MspA1I CMGCKG 1 cut(s) 98
MspI CCGG 1 cut(s) 273
MspR9I CCNGG 1 cut(s) 273
Mva1269I GAATGC 1 cut(s) 184
MwoI GCNNNNNNNGC 2 cut(s) 191, 252
NciI CCSGG 1 cut(s) 273
NcoI CCATGG 1 cut(s) 58
NdeII GATC 1 cut(s) 144
NlaIII CATG 3 cut(s) 62, 130, 242
PctI GAATGC 1 cut(s) 184
PflMI CCANNNNNTGG 1 cut(s) 239
PkrI GCNGC 5 cut(s) 94, 97, 184, 187, 245
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
PspPI GGNCC 2 cut(s) 74, 105
PspPPI RGGWCCY 1 cut(s) 74
PstI CTGCAG 1 cut(s) 97
PvuII CAGCTG 1 cut(s) 98
RseI CAYNNNNRTG 2 cut(s) 63, 131
SaqAI TTAA 1 cut(s) 206
SatI GCNGC 5 cut(s) 93, 96, 183, 186, 244
Sau3AI GATC 1 cut(s) 144
Sau96I GGNCC 2 cut(s) 74, 105
ScrFI CCNGG 1 cut(s) 273
SetI ASST 9 cut(s) 14, 39, 47, 52, 76, 94, 100, 202, 238
SfaNI GCATC 1 cut(s) 242
SfcI CTRYAG 1 cut(s) 93
SinI GGWCC 1 cut(s) 74
SmiMI CAYNNNNRTG 2 cut(s) 63, 131
SsiI CCGC 3 cut(s) 182, 243, 280
SspMI CTAG 2 cut(s) 42, 289
StyD4I CCNGG 1 cut(s) 271
StyI CCWWGG 2 cut(s) 58, 108
TauI GCSGC 2 cut(s) 185, 246
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TscAI CASTG 1 cut(s) 172
TseI GCWGC 3 cut(s) 92, 95, 185
TspDTI ATGAA 2 cut(s) 38, 149
TspRI CASTG 1 cut(s) 172
Van91I CCANNNNNTGG 1 cut(s) 239
VpaK11BI GGWCC 1 cut(s) 74
XspI CTAG 2 cut(s) 42, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.