Rh6DG254100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001615
Physical Location & Seq
Reverse (-)
44435088 .. 44447299
12212 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG254100.1

Sequence Viewer

Length: 432 bp
ATGCTACTGGCCTTGGCAACAGTGGCCACAGCAAGTGCGACCACCGTCAGCCTCGAAGATGCAAAGTTCACCAACCACCATCAGCCTCGAAGATGCCCGATAAGGAATGGACGACGATTGACGCATGAGGCGCCGTTAGTGTCAGTGATTCACCAGATCACAGTGCTTAGGCTTCCACCTCCACTTGACGAGATCGCGGTCGTTGAATTTGTTGCTGGAAATGCAATTCCAGCCCTTGAAGATCTCCTTGCAAGTGTTTTCGTACTTGGGAGAAGCATTAGGGTCGTAGATCCAGGCTCCATCAGAGTAGTCGCAGGACCCGACCGGCTTCGTCAGGTTAGATCCTGGGCGTTTCCGAAATTTGAGGGAGCTATGAGGTTGGGAAGGAACAGAGGAGCTGGAAAGAAAAAGAATAAGTTCGACAATATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

15.68

Weight (kDa)

11.05

Isoelectric Point (pI)

41.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 130
AccII CGCG 1 cut(s) 197
AciI CCGC 1 cut(s) 197
AclWI GGATC 2 cut(s) 284, 336
AcoI YGGCCR 1 cut(s) 24
AcsI RAATTY 2 cut(s) 206, 359
AcyI GRCGYC 1 cut(s) 131
AfaI GTAC 1 cut(s) 264
AgsI TTSAA 2 cut(s) 206, 239
AjnI CCWGG 2 cut(s) 292, 344
AluBI AGCT 2 cut(s) 371, 398
AluI AGCT 2 cut(s) 371, 398
AlwI GGATC 2 cut(s) 284, 336
AoxI GGCC 2 cut(s) 9, 24
ApoI RAATTY 2 cut(s) 206, 359
Asp700I GAANNNNTTC 1 cut(s) 416
AspLEI GCGC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 317
AsuHPI GGTGA 2 cut(s) 61, 143
AvaII GGWCC 1 cut(s) 317
BalI TGGCCA 1 cut(s) 26
BanI GGYRCC 1 cut(s) 130
BccI CCATC 2 cut(s) 87, 308
BceAI ACGGC 1 cut(s) 118
BcgI CGANNNNNNTGC 2 cut(s) 265, 299
BciT130I CCWGG 2 cut(s) 294, 346
BfoI RGCGCY 1 cut(s) 134
BglII AGATCT 1 cut(s) 241
Bme1390I CCNGG 2 cut(s) 294, 346
Bme18I GGWCC 1 cut(s) 317
BmgT120I GGNCC 1 cut(s) 317
BmiI GGNNCC 3 cut(s) 132, 298, 319
BmrFI CCNGG 2 cut(s) 294, 346
BmsI GCATC 2 cut(s) 49, 83
BoxI GACNNNNGTC 1 cut(s) 44
Bpu10I CCTNAGC 1 cut(s) 167
BsaHI GRCGYC 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 12, 345
Bse118I RCCGGY 1 cut(s) 324
Bse1I ACTGG 1 cut(s) 12
BseBI CCWGG 2 cut(s) 294, 346
BseDI CCNNGG 2 cut(s) 12, 345
BseNI ACTGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 408
Bsh1236I CGCG 1 cut(s) 197
Bsh1285I CGRYCG 2 cut(s) 201, 325
BshFI GGCC 2 cut(s) 11, 26
BshNI GGYRCC 1 cut(s) 130
BsiEI CGRYCG 2 cut(s) 201, 325
BsiSI CCGG 1 cut(s) 325
BsnI GGCC 2 cut(s) 11, 26
Bsp143I GATC 5 cut(s) 156, 192, 241, 289, 341
BspACI CCGC 1 cut(s) 197
BspANI GGCC 2 cut(s) 11, 26
BspFNI CGCG 1 cut(s) 197
BspLI GGNNCC 3 cut(s) 132, 298, 319
BspPI GGATC 2 cut(s) 284, 336
BspT107I GGYRCC 1 cut(s) 130
BsrFI RCCGGY 1 cut(s) 324
BsrI ACTGG 1 cut(s) 12
BssAI RCCGGY 1 cut(s) 324
BssECI CCNNGG 2 cut(s) 12, 345
BssMI GATC 5 cut(s) 156, 192, 241, 289, 341
BssNI GRCGYC 1 cut(s) 131
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 2 cut(s) 294, 346
Bst4CI ACNGT 3 cut(s) 22, 46, 163
BstACI GRCGYC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 167
BstFNI CGCG 1 cut(s) 197
BstH2I RGCGCY 1 cut(s) 134
BstHHI GCGC 1 cut(s) 133
BstKTI GATC 5 cut(s) 159, 195, 244, 292, 344
BstMBI GATC 5 cut(s) 156, 192, 241, 289, 341
BstMCI CGRYCG 2 cut(s) 201, 325
BstMWI GCNNNNNNNGC 4 cut(s) 23, 130, 221, 230
BstNI CCWGG 2 cut(s) 294, 346
BstPAI GACNNNNGTC 1 cut(s) 44
BstSCI CCNGG 2 cut(s) 292, 344
BstUI CGCG 1 cut(s) 197
BstX2I RGATCY 3 cut(s) 241, 289, 341
BstYI RGATCY 3 cut(s) 241, 289, 341
BsuRI GGCC 2 cut(s) 11, 26
BtsIMutI CAGTG 3 cut(s) 27, 150, 168
CfoI GCGC 1 cut(s) 133
Cfr10I RCCGGY 1 cut(s) 324
Cfr13I GGNCC 1 cut(s) 317
CseI GACGC 1 cut(s) 130
Csp6I GTAC 1 cut(s) 263
CviAII CATG 1 cut(s) 125
CviQI GTAC 1 cut(s) 263
DdeI CTNAG 1 cut(s) 167
DinI GGCGCC 1 cut(s) 132
DpnI GATC 5 cut(s) 158, 194, 243, 291, 343
DpnII GATC 5 cut(s) 156, 192, 241, 289, 341
EaeI YGGCCR 1 cut(s) 24
Eco130I CCWWGG 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 317
EcoO109I RGGNCCY 1 cut(s) 317
EcoRII CCWGG 2 cut(s) 292, 344
EcoT14I CCWWGG 1 cut(s) 12
EgeI GGCGCC 1 cut(s) 132
EheI GGCGCC 1 cut(s) 132
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 128
FaiI YATR 4 cut(s) 126, 374, 428, 430
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FatI CATG 1 cut(s) 124
GlaI GCGC 1 cut(s) 132
HaeII RGCGCY 1 cut(s) 134
HaeIII GGCC 2 cut(s) 11, 26
HapII CCGG 1 cut(s) 325
HgaI GACGC 1 cut(s) 130
HhaI GCGC 1 cut(s) 133
Hin1I GRCGYC 1 cut(s) 131
Hin1II CATG 1 cut(s) 128
Hin6I GCGC 1 cut(s) 131
HinP1I GCGC 1 cut(s) 131
HinfI GANTC 1 cut(s) 148
HpaII CCGG 1 cut(s) 325
HphI GGTGA 2 cut(s) 61, 143
Hpy166II GTNNAC 1 cut(s) 69
Hpy188I TCNGA 2 cut(s) 305, 357
Hpy8I GTNNAC 1 cut(s) 69
Hpy99I CGWCG 1 cut(s) 117
HpyAV CCTTC 1 cut(s) 378
HpyCH4III ACNGT 3 cut(s) 22, 46, 163
HpyCH4V TGCA 3 cut(s) 62, 224, 251
HpyF10VI GCNNNNNNNGC 4 cut(s) 23, 130, 221, 230
HpyF3I CTNAG 1 cut(s) 167
Hsp92I GRCGYC 1 cut(s) 131
Hsp92II CATG 1 cut(s) 128
HspAI GCGC 1 cut(s) 131
KasI GGCGCC 1 cut(s) 130
Kzo9I GATC 5 cut(s) 156, 192, 241, 289, 341
LmnI GCTCC 3 cut(s) 302, 368, 395
LweI GCATC 2 cut(s) 49, 83
MalI GATC 5 cut(s) 158, 194, 243, 291, 343
MboI GATC 5 cut(s) 156, 192, 241, 289, 341
MboII GAAGA 3 cut(s) 68, 102, 251
MflI RGATCY 3 cut(s) 241, 289, 341
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 3 cut(s) 206, 225, 359
MluNI TGGCCA 1 cut(s) 26
Mly113I GGCGCC 1 cut(s) 131
MnlI CCTC 7 cut(s) 62, 96, 121, 189, 358, 369, 386
Mox20I TGGCCA 1 cut(s) 26
MroXI GAANNNNTTC 1 cut(s) 416
MscI TGGCCA 1 cut(s) 26
Msp20I TGGCCA 1 cut(s) 26
MspI CCGG 1 cut(s) 325
MspR9I CCNGG 2 cut(s) 294, 346
MvaI CCWGG 2 cut(s) 294, 346
MvnI CGCG 1 cut(s) 197
MwoI GCNNNNNNNGC 4 cut(s) 23, 130, 221, 230
NarI GGCGCC 1 cut(s) 131
NdeII GATC 5 cut(s) 156, 192, 241, 289, 341
NlaIII CATG 1 cut(s) 128
NlaIV GGNNCC 3 cut(s) 132, 298, 319
PcsI WCGNNNNNNNCGW 1 cut(s) 318
PdmI GAANNNNTTC 1 cut(s) 416
PfeI GAWTC 1 cut(s) 148
PluTI GGCGCC 1 cut(s) 134
PpuMI RGGWCCY 1 cut(s) 317
PshAI GACNNNNGTC 1 cut(s) 44
Psp5II RGGWCCY 1 cut(s) 317
Psp6I CCWGG 2 cut(s) 292, 344
PspGI CCWGG 2 cut(s) 292, 344
PspN4I GGNNCC 3 cut(s) 132, 298, 319
PspPI GGNCC 1 cut(s) 317
PspPPI RGGWCCY 1 cut(s) 317
PsuI RGATCY 3 cut(s) 241, 289, 341
RsaI GTAC 1 cut(s) 264
RsaNI GTAC 1 cut(s) 263
Sau3AI GATC 5 cut(s) 156, 192, 241, 289, 341
Sau96I GGNCC 1 cut(s) 317
ScrFI CCNGG 2 cut(s) 294, 346
SetI ASST 5 cut(s) 181, 339, 373, 380, 400
SfaNI GCATC 2 cut(s) 49, 83
SfoI GGCGCC 1 cut(s) 132
SinI GGWCC 1 cut(s) 317
Sse9I AATT 3 cut(s) 206, 225, 359
SsiI CCGC 1 cut(s) 197
SspDI GGCGCC 1 cut(s) 130
StyD4I CCNGG 2 cut(s) 292, 344
StyI CCWWGG 1 cut(s) 12
TaaI ACNGT 3 cut(s) 22, 46, 163
TaqI TCGA 3 cut(s) 54, 88, 420
TasI AATT 3 cut(s) 206, 225, 359
TfiI GAWTC 1 cut(s) 148
TscAI CASTG 3 cut(s) 27, 150, 168
TspRI CASTG 3 cut(s) 27, 150, 168
VpaK11BI GGWCC 1 cut(s) 317
XapI RAATTY 2 cut(s) 206, 359
XmnI GAANNNNTTC 1 cut(s) 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.