RchiOBHm_Chr7g0204481

protein trichome birefringence-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
22174953 .. 22175438
486 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18303

Sequence Viewer

Length: 156 bp
ATGGAAACTTTGATTGATTGGATTGATAGTGAAGTCAACATGAGCACTACTTATGTACTTTTTCGAACTTATGCTCCTGTGCATTTCAGGATTTTGAATGGTGAAGATGTAGATATAGAGGAAACAGTTCTTCGCACTCCAATATCCAAATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.95

Weight (kDa)

4.4

Isoelectric Point (pI)

55.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 57
AgsI TTSAA 1 cut(s) 97
AloI GAACNNNNNNTCC 2 cut(s) 58, 90
Alw21I GWGCWC 1 cut(s) 47
Asp700I GAANNNNTTC 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 113
AsuII TTCGAA 1 cut(s) 64
Bbv12I GWGCWC 1 cut(s) 47
BfaI CTAG 1 cut(s) 154
Bpu14I TTCGAA 1 cut(s) 64
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
BsiHKAI GWGCWC 1 cut(s) 47
Bsp119I TTCGAA 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 47
BspT104I TTCGAA 1 cut(s) 64
Bst4CI ACNGT 1 cut(s) 127
BstBI TTCGAA 1 cut(s) 64
Csp6I GTAC 1 cut(s) 56
CviAII CATG 1 cut(s) 40
CviQI GTAC 1 cut(s) 56
FaeI CATG 1 cut(s) 43
FaiI YATR 4 cut(s) 41, 54, 72, 116
FatI CATG 1 cut(s) 39
FspBI CTAG 1 cut(s) 154
FspEI CC 5 cut(s) 4, 73, 84, 90, 104
Hin1II CATG 1 cut(s) 43
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 82
Hsp92II CATG 1 cut(s) 43
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 73, 90
MaeI CTAG 1 cut(s) 154
MboII GAAGA 2 cut(s) 116, 122
MhlI GDGCHC 1 cut(s) 47
MnlI CCTC 1 cut(s) 112
MroXI GAANNNNTTC 1 cut(s) 126
NlaIII CATG 1 cut(s) 43
NspV TTCGAA 1 cut(s) 64
PdmI GAANNNNTTC 1 cut(s) 126
RsaI GTAC 1 cut(s) 57
RsaNI GTAC 1 cut(s) 56
SduI GDGCHC 1 cut(s) 47
SfuI TTCGAA 1 cut(s) 64
SgeI CNNG 3 cut(s) 52, 89, 100
SspMI CTAG 1 cut(s) 154
TaaI ACNGT 1 cut(s) 127
TaqI TCGA 1 cut(s) 64
TatI WGTACW 1 cut(s) 55
XmnI GAANNNNTTC 1 cut(s) 126
XspI CTAG 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.