Rorug04G0195600

Ribosome production factor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
34055659 .. 34056229
571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0195600.1

Sequence Viewer

Length: 249 bp
ATGGCTTCCACCAACTTTGCTCGATGCTGTTTCGTTGGAATCCTATGCATTGCTGTACTTCTTCTCAGCTCAGTTGTAGATGAAATACCTGCAGAAGTTCCTGCTGGGGGAACTTTGCTTAATGTAGGGCCTTGCTCAAAGTTTGCTGACTGCAACAAGTATTGCCAAGAGAATTACAGTCGTGTATTGGGTGGGTTTTGCAAAGAGCTTTCTCCTGGGGGAGAAAGATTTTGCTTGTGTAAAGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

8.73

Weight (kDa)

6.11

Isoelectric Point (pI)

30.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 97
AfaI GTAC 1 cut(s) 57
AfiI CCNNNNNNNGG 1 cut(s) 107
AjnI CCWGG 1 cut(s) 214
AluBI AGCT 2 cut(s) 69, 208
AluI AGCT 2 cut(s) 69, 208
AoxI GGCC 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 216
BfmI CTRYAG 1 cut(s) 90
BfuAI ACCTGC 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 216
BmsI GCATC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 215
Bsc4I CCNNNNNNNGG 1 cut(s) 107
Bse3DI GCAATG 1 cut(s) 48
BseBI CCWGG 1 cut(s) 216
BseDI CCNNGG 1 cut(s) 215
BseLI CCNNNNNNNGG 1 cut(s) 107
BseMI GCAATG 1 cut(s) 48
BseMII CTCAG 2 cut(s) 79, 84
BseYI CCCAGC 1 cut(s) 104
BshFI GGCC 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 107
BsnI GGCC 1 cut(s) 130
BspANI GGCC 1 cut(s) 130
BspCNI CTCAG 2 cut(s) 78, 83
BspMAI CTGCAG 1 cut(s) 94
BspMI ACCTGC 1 cut(s) 97
BsrDI GCAATG 1 cut(s) 48
BssECI CCNNGG 1 cut(s) 215
Bst2UI CCWGG 1 cut(s) 216
Bst4CI ACNGT 1 cut(s) 179
BstDEI CTNAG 2 cut(s) 65, 70
BstNI CCWGG 1 cut(s) 216
BstSCI CCNGG 1 cut(s) 214
BstSFI CTRYAG 1 cut(s) 90
BsuRI GGCC 1 cut(s) 130
BveI ACCTGC 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 56
CspCI CAANNNNNGTGG 1 cut(s) 33
CviJI RGCY 4 cut(s) 5, 69, 130, 208
CviKI_1 RGCY 4 cut(s) 5, 69, 130, 208
CviQI GTAC 1 cut(s) 56
DdeI CTNAG 2 cut(s) 65, 70
EcoO109I RGGNCCY 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 214
EcoT22I ATGCAT 1 cut(s) 50
FaiI YATR 1 cut(s) 46
GsaI CCCAGC 1 cut(s) 108
HaeIII GGCC 1 cut(s) 130
HinfI GANTC 1 cut(s) 39
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4V TGCA 4 cut(s) 48, 92, 153, 201
HpyF3I CTNAG 2 cut(s) 65, 70
LpnPI CCDG 5 cut(s) 90, 102, 114, 201, 228
LweI GCATC 1 cut(s) 14
MboII GAAGA 1 cut(s) 53
MluCI AATT 1 cut(s) 172
MmeI TCCRAC 1 cut(s) 16
Mph1103I ATGCAT 1 cut(s) 50
MseI TTAA 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 216
MvaI CCWGG 1 cut(s) 216
NsiI ATGCAT 1 cut(s) 50
PfeI GAWTC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 214
PspFI CCCAGC 1 cut(s) 104
PspGI CCWGG 1 cut(s) 214
PspPI GGNCC 1 cut(s) 128
PstI CTGCAG 1 cut(s) 94
RsaI GTAC 1 cut(s) 57
RsaNI GTAC 1 cut(s) 56
SaqAI TTAA 1 cut(s) 120
Sau96I GGNCC 1 cut(s) 128
ScrFI CCNGG 1 cut(s) 216
SetI ASST 3 cut(s) 71, 91, 210
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 90
Sse9I AATT 1 cut(s) 172
StyD4I CCNGG 1 cut(s) 214
TaaI ACNGT 1 cut(s) 179
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 172
TatI WGTACW 1 cut(s) 55
TfiI GAWTC 1 cut(s) 39
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 96
Zsp2I ATGCAT 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.