pycom11g21700

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
24781446 .. 24782049
604 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g21700.4

Sequence Viewer

Length: 375 bp
ATGCAAAAACATAAGTGTACCGAAAATTTTGTATCTAAATATATGATACTAAACTATGTAACGAAATGTCCATATTGTAATGAATTAGTAGCACATAAGAAAATATGCAAAAATATAAGTGTACCAAAAAAATCTTTACTAAAATATTTTCTATATAAGATACTTACCATAATGAGAATTAAAATTTATAATTATGAACACCATAAAATTATAAATAAAAAAAGAGAGACATTGAATACATATGCTTGTATAAGACATTTTTCTAAACTAGACAGGTCTATAGCTGGTCACATTCTTCTGGATGGTCAACGTGCAAAAGTAAAATCTCCATCGACTCCCTTAATCTTCATTAACTTCAAATTTTTACTTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

14.7

Weight (kDa)

9.93

Isoelectric Point (pI)

43.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 189, 212
AcsI RAATTY 3 cut(s) 25, 183, 359
AfaI GTAC 2 cut(s) 19, 123
AgsI TTSAA 2 cut(s) 235, 358
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
Alw26I GTCTC 1 cut(s) 221
ApoI RAATTY 3 cut(s) 25, 183, 359
BccI CCATC 2 cut(s) 296, 337
BcoDI GTCTC 1 cut(s) 221
BfaI CTAG 1 cut(s) 269
BfmI CTRYAG 1 cut(s) 279
BseGI GGATG 1 cut(s) 307
BsmAI GTCTC 1 cut(s) 221
BstF5I GGATG 1 cut(s) 307
BstMAI GTCTC 1 cut(s) 221
BstSFI CTRYAG 1 cut(s) 279
BtsCI GGATG 1 cut(s) 307
Csp6I GTAC 2 cut(s) 18, 122
CviJI RGCY 1 cut(s) 284
CviKI_1 RGCY 1 cut(s) 284
CviQI GTAC 2 cut(s) 18, 122
FauNDI CATATG 1 cut(s) 241
FokI GGATG 1 cut(s) 314
FspBI CTAG 1 cut(s) 269
HincII GTYRAC 1 cut(s) 308
HindII GTYRAC 1 cut(s) 308
HinfI GANTC 1 cut(s) 334
Hpy166II GTNNAC 3 cut(s) 18, 122, 308
Hpy188III TCNNGA 1 cut(s) 299
Hpy8I GTNNAC 3 cut(s) 18, 122, 308
HpyCH4IV ACGT 1 cut(s) 310
HpyCH4V TGCA 3 cut(s) 4, 108, 314
HpySE526I ACGT 1 cut(s) 310
LpnPI CCDG 3 cut(s) 259, 270, 284
MaeI CTAG 1 cut(s) 269
MaeII ACGT 1 cut(s) 310
MaeIII GTNAC 2 cut(s) 58, 287
MboII GAAGA 2 cut(s) 287, 337
MluCI AATT 7 cut(s) 25, 83, 177, 183, 190, 207, 359
MlyI GAGTC 1 cut(s) 328
MseI TTAA 4 cut(s) 180, 341, 351, 373
NdeI CATATG 1 cut(s) 241
NmuCI GTSAC 1 cut(s) 287
PleI GAGTC 1 cut(s) 328
PpsI GAGTC 1 cut(s) 328
PsiI TTATAA 2 cut(s) 189, 212
RsaI GTAC 2 cut(s) 19, 123
RsaNI GTAC 2 cut(s) 18, 122
SaqAI TTAA 4 cut(s) 180, 341, 351, 373
SchI GAGTC 1 cut(s) 328
SetI ASST 3 cut(s) 278, 286, 313
SfcI CTRYAG 1 cut(s) 279
SgeI CNNG 6 cut(s) 258, 281, 286, 297, 311, 323
Sse9I AATT 7 cut(s) 25, 83, 177, 183, 190, 207, 359
SspI AATATT 1 cut(s) 146
SspMI CTAG 1 cut(s) 269
TaiI ACGT 1 cut(s) 313
TaqI TCGA 1 cut(s) 332
TasI AATT 7 cut(s) 25, 83, 177, 183, 190, 207, 359
Tru1I TTAA 4 cut(s) 180, 341, 351, 373
Tru9I TTAA 4 cut(s) 180, 341, 351, 373
TseFI GTSAC 1 cut(s) 287
Tsp45I GTSAC 1 cut(s) 287
TspDTI ATGAA 3 cut(s) 96, 210, 337
XapI RAATTY 3 cut(s) 25, 183, 359
XspI CTAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.