Rh6BG263200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0001615
Physical Location & Seq
Reverse (-)
47844778 .. 47853299
8522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG263200.1

Sequence Viewer

Length: 225 bp
ATGAAGATTGATAAAAGACTTATTCAGTTTACTAATGAAAAACTGATTTACACTACTCTGCCACCAACCTTGGTCGTAGATCCAGGCTCCATCAGAGTAGTCGCAGGACCCGACCGGCTCCGTCAGGTTAGATCCTGGGCATTTCCAAAATTCGAGGGAGCTATGAGTCGAAGCGGACCCGAACGGAGACGAGCCAAAGTAGATTCTCATCATCTCCGCGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.5

Weight (kDa)

11.2

Isoelectric Point (pI)

51.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 219
AciI CCGC 2 cut(s) 174, 217
AclWI GGATC 2 cut(s) 74, 126
AcsI RAATTY 1 cut(s) 149
AjnI CCWGG 2 cut(s) 82, 134
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 181
AlwI GGATC 2 cut(s) 74, 126
ApoI RAATTY 1 cut(s) 149
AspLEI GCGC 1 cut(s) 221
AspS9I GGNCC 2 cut(s) 107, 176
AvaII GGWCC 2 cut(s) 107, 176
BccI CCATC 1 cut(s) 98
BciT130I CCWGG 2 cut(s) 84, 136
BcoDI GTCTC 1 cut(s) 181
Bme1390I CCNGG 2 cut(s) 84, 136
Bme18I GGWCC 2 cut(s) 107, 176
BmgT120I GGNCC 2 cut(s) 107, 176
BmiI GGNNCC 4 cut(s) 88, 109, 119, 178
BmrFI CCNGG 2 cut(s) 84, 136
BsaBI GATNNNNATC 1 cut(s) 207
BsaJI CCNNGG 2 cut(s) 69, 135
Bse118I RCCGGY 1 cut(s) 114
Bse8I GATNNNNATC 1 cut(s) 207
BseBI CCWGG 2 cut(s) 84, 136
BseDI CCNNGG 2 cut(s) 69, 135
BseJI GATNNNNATC 1 cut(s) 207
Bsh1236I CGCG 1 cut(s) 219
Bsh1285I CGRYCG 1 cut(s) 115
BsiEI CGRYCG 1 cut(s) 115
BsiSI CCGG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 181
BsmBI CGTCTC 1 cut(s) 181
Bsp143I GATC 2 cut(s) 79, 131
BspACI CCGC 2 cut(s) 174, 217
BspFNI CGCG 1 cut(s) 219
BspLI GGNNCC 4 cut(s) 88, 109, 119, 178
BspPI GGATC 2 cut(s) 74, 126
BsrFI RCCGGY 1 cut(s) 114
BssAI RCCGGY 1 cut(s) 114
BssECI CCNNGG 2 cut(s) 69, 135
BssMI GATC 2 cut(s) 79, 131
BssT1I CCWWGG 1 cut(s) 69
Bst2UI CCWGG 2 cut(s) 84, 136
BstFNI CGCG 1 cut(s) 219
BstHHI GCGC 1 cut(s) 221
BstKTI GATC 2 cut(s) 82, 134
BstMAI GTCTC 1 cut(s) 181
BstMBI GATC 2 cut(s) 79, 131
BstMCI CGRYCG 1 cut(s) 115
BstNI CCWGG 2 cut(s) 84, 136
BstSCI CCNGG 2 cut(s) 82, 134
BstUI CGCG 1 cut(s) 219
BstX2I RGATCY 2 cut(s) 79, 131
BstYI RGATCY 2 cut(s) 79, 131
CfoI GCGC 1 cut(s) 221
Cfr10I RCCGGY 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 107, 176
CspCI CAANNNNNGTGG 2 cut(s) 51, 86
CviAII CATG 1 cut(s) 222
CviJI RGCY 4 cut(s) 87, 118, 161, 194
CviKI_1 RGCY 4 cut(s) 87, 118, 161, 194
DpnI GATC 2 cut(s) 81, 133
DpnII GATC 2 cut(s) 79, 131
Eco130I CCWWGG 1 cut(s) 69
Eco47I GGWCC 2 cut(s) 107, 176
EcoO109I RGGNCCY 1 cut(s) 107
EcoRII CCWGG 2 cut(s) 82, 134
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
Esp3I CGTCTC 1 cut(s) 181
FaeI CATG 1 cut(s) 225
FaiI YATR 2 cut(s) 164, 223
FatI CATG 1 cut(s) 221
GlaI GCGC 1 cut(s) 220
HapII CCGG 1 cut(s) 115
HhaI GCGC 1 cut(s) 221
Hin1II CATG 1 cut(s) 225
Hin6I GCGC 1 cut(s) 219
HinP1I GCGC 1 cut(s) 219
HinfI GANTC 2 cut(s) 166, 203
HpaII CCGG 1 cut(s) 115
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 30
Hsp92II CATG 1 cut(s) 225
HspAI GCGC 1 cut(s) 219
Kzo9I GATC 2 cut(s) 79, 131
LmnI GCTCC 3 cut(s) 92, 123, 158
LpnPI CCDG 7 cut(s) 69, 90, 96, 110, 121, 128, 148
MalI GATC 2 cut(s) 81, 133
MboI GATC 2 cut(s) 79, 131
MboII GAAGA 1 cut(s) 16
MflI RGATCY 2 cut(s) 79, 131
MluCI AATT 1 cut(s) 149
MlyI GAGTC 1 cut(s) 175
MnlI CCTC 1 cut(s) 148
MspI CCGG 1 cut(s) 115
MspR9I CCNGG 2 cut(s) 84, 136
MvaI CCWGG 2 cut(s) 84, 136
MvnI CGCG 1 cut(s) 219
NdeII GATC 2 cut(s) 79, 131
NlaIII CATG 1 cut(s) 225
NlaIV GGNNCC 4 cut(s) 88, 109, 119, 178
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PfeI GAWTC 1 cut(s) 203
PleI GAGTC 1 cut(s) 174
PpsI GAGTC 1 cut(s) 174
PpuMI RGGWCCY 1 cut(s) 107
Psp5II RGGWCCY 1 cut(s) 107
Psp6I CCWGG 2 cut(s) 82, 134
PspGI CCWGG 2 cut(s) 82, 134
PspN4I GGNNCC 4 cut(s) 88, 109, 119, 178
PspPI GGNCC 2 cut(s) 107, 176
PspPPI RGGWCCY 1 cut(s) 107
PsuI RGATCY 2 cut(s) 79, 131
Sau3AI GATC 2 cut(s) 79, 131
Sau96I GGNCC 2 cut(s) 107, 176
SchI GAGTC 1 cut(s) 175
ScrFI CCNGG 2 cut(s) 84, 136
SetI ASST 3 cut(s) 71, 129, 163
SinI GGWCC 2 cut(s) 107, 176
Sse9I AATT 1 cut(s) 149
SsiI CCGC 2 cut(s) 174, 217
StyD4I CCNGG 2 cut(s) 82, 134
StyI CCWWGG 1 cut(s) 69
TaqI TCGA 2 cut(s) 153, 169
TasI AATT 1 cut(s) 149
TfiI GAWTC 1 cut(s) 203
TspDTI ATGAA 2 cut(s) 17, 51
TspGWI ACGGA 2 cut(s) 110, 199
VpaK11BI GGWCC 2 cut(s) 107, 176
XapI RAATTY 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.