Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

SuperScaffold_111

Orthogroup ID

OG0000641

Physical Location & Seq

Genomic Coordinates Reverse (-)

2388695 .. 2389487

Gene Structure 793 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom111g03970.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 660 bp

ATGATTCTCTTCCAGGACTACACTGCTAAGCTTTCTGATTTTGGGCTCGCAAAAGATGCTCCTGAGGGAGACAAAACTCATGTCTCCACCCGAGTTATGGGCACTTACGGTTATGCAGCCCCTGAGTATGTAATGACAGGACACCTCACTTCAAAAAGCGATGTCTATAGCTTCGGTGTGGTTTTGCTTGAAATGTTGGTTGGTAAAAGATCTATGGACAAAAACCGGCCCAATGGGGAGCATAACTTGGTTGAGTGGGCACGCCCGCATCTGGGAGACAGGCAAAGGTTCTACCGTCTAATAGATCCTAGACTTGAAGGCCACTTCTCTATCAAAGGTGCTCAGAAAGCGTTTCATTTGGCTGCCCGTTGTCTTAGCCGTGACCCCAAGGCTAGACCTCTGATGAGTGAAGTCGTTGAAGTGCTGAAGCCTCTTCCTGACCTCAATGACATGGCCAGATCCTCATCTTACTACCAAGCCTTGCAAGCTCCTGGGTCTAATCCAAGTTCTCGAAATGGCGGTAGAGGGCTGGTCGGGATTTCAAGGAACGGACAACCAACTAGAACCCGATCGATGCCAAATGGTCCGCATGCCTCACCATGTCACCTAAACTATCTTAACCGATCACCCAGACCTATTTCGCAATCTGCACAATCGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

220

Amino Acids

24.29

Weight (kDa)

9.78

Isoelectric Point (pI)

46.23

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Pkinase	PF00069	2 - 140	4.4e-18	Protein kinase domain
PK_Tyr_Ser-Thr	PF07714	5 - 142	2e-15	Protein tyrosine and serine/threonine kinase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000641)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G01300 AT3G28690 AT3G28690 AT3G28690 AT5G15080
fragaria_vesca	FvH4_1g02650 FvH4_4g31950 FvH4_4g31950 FvH4_6g49010 FvH4_6g49010 FvH4_6g49010 FvH4_6g49010 FvH4_6g49270
malus_domestica	MD09G1046600.v1.1 MD09G1048900.v1.1 MD13G1078900.v1.1 MD15G1168500.v1.1 MD16G1078600.v1.1 MD17G1047100.v1.1 MD17G1048900.v1.1
prunus_persica	Prupe.1G267900_v2.0.a1 Prupe.1G267900_v2.0.a1 Prupe.1G267900_v2.0.a1 Prupe.3G270000_v2.0.a1 Prupe.3G272000_v2.0.a1 Prupe.7G248000_v2.0.a1
pyrus_communis	pycom111g03700 pycom111g03970 pycom111g03980 pycom13g06850 pycom15g15030 pycom16g06800 pycom17g04200 pycom17g04390
rosa_chinensis	RchiOBHm_Chr2g0087681 RchiOBHm_Chr2g0104451 RchiOBHm_Chr2g0168861 RchiOBHm_Chr2g0169151 RchiOBHm_Chr4g0440601
rosa_laevigata	RLG00000004259 RLG00000015892 RLG00000019191 RLG00000037088
rosa_multiflora	Rmu_sc0000358.1_g000007 Rmu_sc0008018.1_g000004 Rmu_ssc0000393.1_g000008
rosa_roxburghii	Rroxscaffold_1G00021930 Rroxscaffold_2G00082390 Rroxscaffold_2G00082620 Rroxscaffold_2G00153290 Rroxscaffold_5G00381430
rosa_rugosa	Rorug01G0478300 Rorug02G0535700 Rorug02G0535800 Rorug02G0537600 Rorug04G0327000
rosa_samantha	Rh2AG032300 Rh2AG606800 Rh2AG609200 Rh2BG031400 Rh2BG619600 Rh2BG622200 Rh2CG031800 Rh2CG588200 Rh2CG590900 Rh2DG031700 Rh2DG630200 Rh2DG632800 Rh4AG378900 Rh4CG406200 Rh4DG385400 Rh6CG197400
rosa_wichuraiana	Rw2G002520 Rw2G050310 Rw2G050530 Rw4G032540 Rw4G032580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	266, 519, 587
AclWI	GGATC	2 cut(s)	299, 453
AcoI	YGGCCR	1 cut(s)	453
AcuI	CTGAAG	1 cut(s)	446
AfiI	CCNNNNNNNGG	3 cut(s)	97, 271, 272
AgsI	TTSAA	5 cut(s)	153, 191, 317, 419, 543
AjnI	CCWGG	2 cut(s)	12, 490
AjuI	GAANNNNNNNTTGG	2 cut(s)	183, 215
AluBI	AGCT	3 cut(s)	31, 171, 488
AluI	AGCT	3 cut(s)	31, 171, 488
Alw21I	GWGCWC	1 cut(s)	343
Alw26I	GTCTC	3 cut(s)	63, 88, 270
AlwI	GGATC	2 cut(s)	299, 453
AlwNI	CAGNNNCTG	1 cut(s)	122
Ama87I	CYCGRG	1 cut(s)	90
AoxI	GGCC	3 cut(s)	227, 319, 453
ApeKI	GCWGC	2 cut(s)	116, 362
ArsI	GACNNNNNNTTYG	2 cut(s)	66, 98
AspS9I	GGNCC	2 cut(s)	228, 584
AsuHPI	GGTGA	3 cut(s)	588, 596, 618
AvaI	CYCGRG	1 cut(s)	90
AvaII	GGWCC	1 cut(s)	584
AxyI	CCTNAGG	1 cut(s)	63
BaeGI	GKGCMC	2 cut(s)	104, 262
BalI	TGGCCA	1 cut(s)	455
BanII	GRGCYC	1 cut(s)	48
Bbv12I	GWGCWC	1 cut(s)	343
BbvI	GCAGC	2 cut(s)	128, 349
BceAI	ACGGC	1 cut(s)	363
BciT130I	CCWGG	2 cut(s)	14, 492
BcoDI	GTCTC	3 cut(s)	63, 88, 270
BfaI	CTAG	3 cut(s)	309, 393, 561
BfmI	CTRYAG	1 cut(s)	166
BglII	AGATCT	1 cut(s)	209
BisI	GCNGC	2 cut(s)	117, 363
BlpI	GCTNAGC	1 cut(s)	27
BlsI	GCNGC	2 cut(s)	118, 364
Bme1390I	CCNGG	2 cut(s)	14, 492
Bme18I	GGWCC	1 cut(s)	584
BmeT110I	CYCGRG	1 cut(s)	90
BmgT120I	GGNCC	2 cut(s)	228, 584
BmrFI	CCNGG	2 cut(s)	14, 492
BmsI	GCATC	3 cut(s)	46, 277, 564
Bpu1102I	GCTNAGC	1 cut(s)	27
Bsa29I	ATCGAT	1 cut(s)	572
BsaBI	GATNNNNATC	1 cut(s)	463
BsaJI	CCNNGG	2 cut(s)	387, 491
Bsc4I	CCNNNNNNNGG	3 cut(s)	97, 271, 272
Bse118I	RCCGGY	1 cut(s)	225
Bse21I	CCTNAGG	1 cut(s)	63
Bse8I	GATNNNNATC	1 cut(s)	463
BseBI	CCWGG	2 cut(s)	14, 492
BseCI	ATCGAT	1 cut(s)	572
BseDI	CCNNGG	2 cut(s)	387, 491
BseJI	GATNNNNATC	1 cut(s)	463
BseLI	CCNNNNNNNGG	3 cut(s)	97, 271, 272
BseMII	CTCAG	3 cut(s)	54, 114, 356
BseSI	GKGCMC	2 cut(s)	104, 262
BseXI	GCAGC	2 cut(s)	128, 349
BsgI	GTGCAG	1 cut(s)	633
Bsh1285I	CGRYCG	1 cut(s)	572
BshFI	GGCC	3 cut(s)	229, 321, 455
BshVI	ATCGAT	1 cut(s)	572
BsiEI	CGRYCG	1 cut(s)	572
BsiHKAI	GWGCWC	1 cut(s)	343
BsiHKCI	CYCGRG	1 cut(s)	90
BsiSI	CCGG	1 cut(s)	226
BslI	CCNNNNNNNGG	3 cut(s)	97, 271, 272
BsmAI	GTCTC	3 cut(s)	63, 88, 270
BsnI	GGCC	3 cut(s)	229, 321, 455
BsoBI	CYCGRG	1 cut(s)	90
Bsp1286I	GDGCHC	4 cut(s)	48, 104, 262, 343
Bsp143I	GATC	5 cut(s)	209, 304, 458, 569, 623
Bsp1720I	GCTNAGC	1 cut(s)	27
BspACI	CCGC	3 cut(s)	266, 519, 587
BspANI	GGCC	3 cut(s)	229, 321, 455
BspCNI	CTCAG	3 cut(s)	55, 115, 355
BspDI	ATCGAT	1 cut(s)	572
BspPI	GGATC	2 cut(s)	299, 453
BsrFI	RCCGGY	1 cut(s)	225
BssAI	RCCGGY	1 cut(s)	225
BssECI	CCNNGG	2 cut(s)	387, 491
BssMI	GATC	5 cut(s)	209, 304, 458, 569, 623
BssT1I	CCWWGG	1 cut(s)	387
Bst2UI	CCWGG	2 cut(s)	14, 492
Bst4CI	ACNGT	2 cut(s)	110, 296
Bst6I	CTCTTC	2 cut(s)	14, 438
BstAPI	GCANNNNNTGC	1 cut(s)	56
BstC8I	GCNNGC	5 cut(s)	48, 262, 266, 486, 591
BstDEI	CTNAG	5 cut(s)	27, 63, 123, 342, 374
BstKTI	GATC	5 cut(s)	212, 307, 461, 572, 626
BstMAI	GTCTC	3 cut(s)	63, 88, 270
BstMBI	GATC	5 cut(s)	209, 304, 458, 569, 623
BstMCI	CGRYCG	1 cut(s)	572
BstMWI	GCNNNNNNNGC	3 cut(s)	56, 347, 485
BstNI	CCWGG	2 cut(s)	14, 492
BstNSI	RCATGY	1 cut(s)	593
BstSCI	CCNGG	2 cut(s)	12, 490
BstSFI	CTRYAG	1 cut(s)	166
BstSLI	GKGCMC	2 cut(s)	104, 262
BstV1I	GCAGC	2 cut(s)	128, 349
BstX2I	RGATCY	3 cut(s)	209, 304, 458
BstYI	RGATCY	3 cut(s)	209, 304, 458
Bsu15I	ATCGAT	1 cut(s)	572
Bsu36I	CCTNAGG	1 cut(s)	63
BsuRI	GGCC	3 cut(s)	229, 321, 455
BsuTUI	ATCGAT	1 cut(s)	572
BtgZI	GCGATG	1 cut(s)	174
BtsI	GCAGTG	1 cut(s)	21
BtsIMutI	CAGTG	1 cut(s)	21
Cac8I	GCNNGC	5 cut(s)	48, 262, 266, 486, 591
CaiI	CAGNNNCTG	1 cut(s)	122
Cfr10I	RCCGGY	1 cut(s)	225
Cfr13I	GGNCC	2 cut(s)	228, 584
ClaI	ATCGAT	1 cut(s)	572
CviAII	CATG	4 cut(s)	80, 451, 590, 600
DdeI	CTNAG	5 cut(s)	27, 63, 123, 342, 374
DpnI	GATC	5 cut(s)	211, 306, 460, 571, 625
DpnII	GATC	5 cut(s)	209, 304, 458, 569, 623
EaeI	YGGCCR	1 cut(s)	453
Eam1104I	CTCTTC	2 cut(s)	14, 438
EarI	CTCTTC	2 cut(s)	14, 438
Eco130I	CCWWGG	1 cut(s)	387
Eco24I	GRGCYC	1 cut(s)	48
Eco47I	GGWCC	1 cut(s)	584
Eco57I	CTGAAG	1 cut(s)	446
Eco81I	CCTNAGG	1 cut(s)	63
Eco88I	CYCGRG	1 cut(s)	90
EcoRII	CCWGG	2 cut(s)	12, 490
EcoT14I	CCWWGG	1 cut(s)	387
EcoT38I	GRGCYC	1 cut(s)	48
ErhI	CCWWGG	1 cut(s)	387
FaeI	CATG	4 cut(s)	83, 454, 593, 603
FatI	CATG	4 cut(s)	79, 450, 589, 599
FauI	CCCGC	1 cut(s)	273
Fnu4HI	GCNGC	2 cut(s)	117, 363
FriOI	GRGCYC	1 cut(s)	48
Fsp4HI	GCNGC	2 cut(s)	117, 363
FspBI	CTAG	3 cut(s)	309, 393, 561
GluI	GCNGC	2 cut(s)	117, 363
HaeIII	GGCC	3 cut(s)	229, 321, 455
HapII	CCGG	1 cut(s)	226
Hin1II	CATG	4 cut(s)	83, 454, 593, 603
HindIII	AAGCTT	1 cut(s)	29
HinfI	GANTC	1 cut(s)	4
HpaII	CCGG	1 cut(s)	226
HphI	GGTGA	3 cut(s)	588, 596, 618
Hpy188I	TCNGA	3 cut(s)	37, 345, 402
Hpy188III	TCNNGA	4 cut(s)	62, 437, 510, 535
HpyAV	CCTTC	1 cut(s)	311
HpyCH4III	ACNGT	2 cut(s)	110, 296
HpyCH4V	TGCA	3 cut(s)	116, 484, 650
HpyF10VI	GCNNNNNNNGC	3 cut(s)	56, 347, 485
HpyF3I	CTNAG	5 cut(s)	27, 63, 123, 342, 374
Hsp92II	CATG	4 cut(s)	83, 454, 593, 603
Kzo9I	GATC	5 cut(s)	209, 304, 458, 569, 623
LmnI	GCTCC	3 cut(s)	64, 238, 493
Lsp1109I	GCAGC	2 cut(s)	128, 349
LweI	GCATC	3 cut(s)	46, 277, 564
MaeI	CTAG	3 cut(s)	309, 393, 561
MaeIII	GTNAC	2 cut(s)	380, 602
MalI	GATC	5 cut(s)	211, 306, 460, 571, 625
MboI	GATC	5 cut(s)	209, 304, 458, 569, 623
MboII	GAAGA	1 cut(s)	425
MflI	RGATCY	3 cut(s)	209, 304, 458
MhlI	GDGCHC	4 cut(s)	48, 104, 262, 343
MlsI	TGGCCA	1 cut(s)	455
MluNI	TGGCCA	1 cut(s)	455
MnlI	CCTC	8 cut(s)	58, 155, 408, 441, 452, 472, 518, 604
Mox20I	TGGCCA	1 cut(s)	455
MscI	TGGCCA	1 cut(s)	455
MseI	TTAA	1 cut(s)	618
Msp20I	TGGCCA	1 cut(s)	455
MspI	CCGG	1 cut(s)	226
MspR9I	CCNGG	2 cut(s)	14, 492
MvaI	CCWGG	2 cut(s)	14, 492
MwoI	GCNNNNNNNGC	3 cut(s)	56, 347, 485
NdeII	GATC	5 cut(s)	209, 304, 458, 569, 623
NlaIII	CATG	4 cut(s)	83, 454, 593, 603
NmuCI	GTSAC	2 cut(s)	380, 602
NspI	RCATGY	1 cut(s)	593
PaeI	GCATGC	1 cut(s)	593
PfeI	GAWTC	1 cut(s)	4
PfoI	TCCNGGA	1 cut(s)	12
PkrI	GCNGC	2 cut(s)	118, 364
Ple19I	CGATCG	1 cut(s)	572
Psp6I	CCWGG	2 cut(s)	12, 490
PspGI	CCWGG	2 cut(s)	12, 490
PspPI	GGNCC	2 cut(s)	228, 584
PstNI	CAGNNNCTG	1 cut(s)	122
PsuI	RGATCY	3 cut(s)	209, 304, 458
PvuI	CGATCG	1 cut(s)	572
SaqAI	TTAA	1 cut(s)	618
SatI	GCNGC	2 cut(s)	117, 363
Sau3AI	GATC	5 cut(s)	209, 304, 458, 569, 623
Sau96I	GGNCC	2 cut(s)	228, 584
ScrFI	CCNGG	2 cut(s)	14, 492
SduI	GDGCHC	4 cut(s)	48, 104, 262, 343
SfaNI	GCATC	3 cut(s)	46, 277, 564
SfcI	CTRYAG	1 cut(s)	166
SinI	GGWCC	1 cut(s)	584
SphI	GCATGC	1 cut(s)	593
SsiI	CCGC	3 cut(s)	266, 519, 587
SspMI	CTAG	3 cut(s)	309, 393, 561
StyD4I	CCNGG	2 cut(s)	12, 490
StyI	CCWWGG	1 cut(s)	387
TaaI	ACNGT	2 cut(s)	110, 296
TaqI	TCGA	2 cut(s)	511, 572
TfiI	GAWTC	1 cut(s)	4
Tru1I	TTAA	1 cut(s)	618
Tru9I	TTAA	1 cut(s)	618
TscAI	CASTG	1 cut(s)	28
TseFI	GTSAC	2 cut(s)	380, 602
TseI	GCWGC	2 cut(s)	116, 362
Tsp45I	GTSAC	2 cut(s)	380, 602
TspDTI	ATGAA	1 cut(s)	344
TspGWI	ACGGA	1 cut(s)	564
TspRI	CASTG	1 cut(s)	28
VpaK11BI	GGWCC	1 cut(s)	584
XceI	RCATGY	1 cut(s)	593
XcmI	CCANNNNNNNNNTGG	1 cut(s)	94
XspI	CTAG	3 cut(s)	309, 393, 561

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.