Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr17

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Forward (+)

1969655 .. 1969954

Gene Structure 300 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGGGAGGGGACGGGACGGGACAGGACGGACCGGAACGGAACGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGGTGAGGTGGAACGAAAATTCACCCAAAACTCGTCCCGTGGAACAGCTCGTTCCACCTGTTTTAGGCACACCAAACGTGGGACGGAACGCCTTGTCCACTCTGTTCCGTCCCGTCCCACGTACCAAATGGTACCTTATTGTTGGAGAAAAAAGCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

100

Amino Acids

11.02

Weight (kDa)

11.48

Isoelectric Point (pI)

74.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	102
Acc65I	GGTACC	1 cut(s)	273
AccB1I	GGYRCC	1 cut(s)	273
AcsI	RAATTY	1 cut(s)	160
AfaI	GTAC	2 cut(s)	265, 275
AfiI	CCNNNNNNNGG	3 cut(s)	63, 206, 221
AjnI	CCWGG	1 cut(s)	137
AleI	CACNNNNGTG	1 cut(s)	120
AloI	GAACNNNNNNTCC	2 cut(s)	221, 253
AluBI	AGCT	2 cut(s)	190, 297
AluI	AGCT	2 cut(s)	190, 297
Alw26I	GTCTC	1 cut(s)	82
ApoI	RAATTY	1 cut(s)	160
Asp718I	GGTACC	1 cut(s)	273
AspS9I	GGNCC	1 cut(s)	29
AsuHPI	GGTGA	2 cut(s)	156, 157
AvaII	GGWCC	1 cut(s)	29
BanI	GGYRCC	1 cut(s)	273
BccI	CCATC	1 cut(s)	57
BciT130I	CCWGG	1 cut(s)	139
BcoDI	GTCTC	1 cut(s)	82
Bme1390I	CCNGG	1 cut(s)	139
Bme18I	GGWCC	1 cut(s)	29
BmgT120I	GGNCC	1 cut(s)	29
BmiI	GGNNCC	1 cut(s)	275
BmrFI	CCNGG	1 cut(s)	139
BmsI	GCATC	1 cut(s)	43
BsaAI	YACGTR	1 cut(s)	263
BsaJI	CCNNGG	4 cut(s)	58, 115, 138, 180
BsaWI	WCCGGW	1 cut(s)	31
Bsc4I	CCNNNNNNNGG	3 cut(s)	63, 206, 221
BseBI	CCWGG	1 cut(s)	139
BseDI	CCNNGG	4 cut(s)	58, 115, 138, 180
BseGI	GGATG	2 cut(s)	68, 125
BseLI	CCNNNNNNNGG	3 cut(s)	63, 206, 221
BshNI	GGYRCC	1 cut(s)	273
BsiSI	CCGG	1 cut(s)	32
BslFI	GGGAC	7 cut(s)	23, 28, 33, 162, 237, 237, 242
BslI	CCNNNNNNNGG	3 cut(s)	63, 206, 221
BsmAI	GTCTC	1 cut(s)	82
BsmBI	CGTCTC	1 cut(s)	82
BsmFI	GGGAC	7 cut(s)	23, 28, 33, 162, 237, 237, 242
BspLI	GGNNCC	1 cut(s)	275
BspT107I	GGYRCC	1 cut(s)	273
BssECI	CCNNGG	4 cut(s)	58, 115, 138, 180
Bst2UI	CCWGG	1 cut(s)	139
BstBAI	YACGTR	1 cut(s)	263
BstDSI	CCRYGG	2 cut(s)	115, 180
BstENI	CCTNNNNNAGG	1 cut(s)	204
BstF5I	GGATG	2 cut(s)	68, 125
BstMAI	GTCTC	1 cut(s)	82
BstNI	CCWGG	1 cut(s)	139
BstSCI	CCNGG	1 cut(s)	137
BstXI	CCANNNNNNTGG	1 cut(s)	122
BtgI	CCRYGG	2 cut(s)	115, 180
BtsCI	GGATG	2 cut(s)	68, 125
Cfr13I	GGNCC	1 cut(s)	29
CpoI	CGGWCCG	1 cut(s)	29
Csp6I	GTAC	2 cut(s)	264, 274
CspI	CGGWCCG	1 cut(s)	29
CviJI	RGCY	2 cut(s)	190, 297
CviKI_1	RGCY	2 cut(s)	190, 297
CviQI	GTAC	2 cut(s)	264, 274
Eco47I	GGWCC	1 cut(s)	29
EcoNI	CCTNNNNNAGG	1 cut(s)	204
EcoRII	CCWGG	1 cut(s)	137
Esp3I	CGTCTC	1 cut(s)	82
FaiI	YATR	1 cut(s)	102
FaqI	GGGAC	7 cut(s)	23, 28, 33, 162, 237, 237, 242
FokI	GGATG	2 cut(s)	75, 132
HapII	CCGG	1 cut(s)	32
HinfI	GANTC	1 cut(s)	130
HpaII	CCGG	1 cut(s)	32
HphI	GGTGA	2 cut(s)	156, 157
Hpy166II	GTNNAC	1 cut(s)	240
Hpy188I	TCNGA	1 cut(s)	62
Hpy8I	GTNNAC	1 cut(s)	240
HpyAV	CCTTC	1 cut(s)	78
HpyCH4IV	ACGT	2 cut(s)	219, 262
HpySE526I	ACGT	2 cut(s)	219, 262
KpnI	GGTACC	1 cut(s)	277
LmnI	GCTCC	1 cut(s)	45
LpnPI	CCDG	5 cut(s)	8, 45, 124, 151, 213
LweI	GCATC	1 cut(s)	43
MaeII	ACGT	2 cut(s)	219, 262
MboII	GAAGA	2 cut(s)	90, 93
MluCI	AATT	2 cut(s)	103, 160
MlyI	GAGTC	1 cut(s)	139
MmeI	TCCRAC	1 cut(s)	265
MnlI	CCTC	4 cut(s)	68, 68, 89, 141
MslI	CAYNNNNRTG	1 cut(s)	120
MspI	CCGG	1 cut(s)	32
MspR9I	CCNGG	1 cut(s)	139
MvaI	CCWGG	1 cut(s)	139
NlaIV	GGNNCC	1 cut(s)	275
OliI	CACNNNNGTG	1 cut(s)	120
PleI	GAGTC	1 cut(s)	138
PpsI	GAGTC	1 cut(s)	138
Ppu21I	YACGTR	1 cut(s)	263
PsiI	TTATAA	1 cut(s)	102
Psp6I	CCWGG	1 cut(s)	137
PspGI	CCWGG	1 cut(s)	137
PspN4I	GGNNCC	1 cut(s)	275
PspPI	GGNCC	1 cut(s)	29
RsaI	GTAC	2 cut(s)	265, 275
RsaNI	GTAC	2 cut(s)	264, 274
RseI	CAYNNNNRTG	1 cut(s)	120
Rsr2I	CGGWCCG	1 cut(s)	29
RsrII	CGGWCCG	1 cut(s)	29
Sau96I	GGNCC	1 cut(s)	29
SchI	GAGTC	1 cut(s)	139
ScrFI	CCNGG	1 cut(s)	139
SetI	ASST	8 cut(s)	100, 152, 192, 202, 222, 265, 279, 299
SfaNI	GCATC	1 cut(s)	43
SinI	GGWCC	1 cut(s)	29
SmiMI	CAYNNNNRTG	1 cut(s)	120
Sse9I	AATT	2 cut(s)	103, 160
StyD4I	CCNGG	1 cut(s)	137
TaiI	ACGT	2 cut(s)	222, 265
TasI	AATT	2 cut(s)	103, 160
TspGWI	ACGGA	6 cut(s)	42, 52, 106, 132, 239, 241
VpaK11BI	GGWCC	1 cut(s)	29
XagI	CCTNNNNNAGG	1 cut(s)	204
XapI	RAATTY	1 cut(s)	160
XcmI	CCANNNNNNNNNTGG	1 cut(s)	267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.