Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr17

Orthogroup ID

OG0001410

Physical Location & Seq

Genomic Coordinates Reverse (-)

2607648 .. 2608112

Gene Structure 465 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 465 bp

ATGGGATGGGACGGGACGGGACAGGACGGAACGGAACGAAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACGGAGATGTTATAATTTTGTGTTCCACGAATGTGGAACGAGTCGTTCCAGGGGGGTGATGTGGAACGAAAATTCACCCAAAACTCGTCCCGTGGAACAGCTCGTTCCACCCATTTTAAGCGCACCAAACGTGGGACGGAACACCTTGTCCCACTCTGTTCCATCCCGTCCCGCGTACCGAACGGTACCTAAGGGTGGAGTTGCTCTTAGGGATGCGCTGCACCTTTGCTCTGATTGGAGGTTGAAAAGCAAAAGGTCCCAGAGAGGAGGGTACGTGTCTCGTACATGTCTCATCTCTAATTACGTCCACCAACTTAACCACAACTTGACACTGTTAAATTTAATATATAAAAATAAAATAAAACATCAACAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

155

Amino Acids

17.51

Weight (kDa)

10.79

Isoelectric Point (pI)

73.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001410)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Species

Orthologous Gene IDs

pyrus_communis

pycom01g05420 pycom01g06550 pycom01g06870 pycom01g08080 pycom01g08570 pycom01g09470 pycom02g02660 pycom02g08200 pycom02g11900 pycom02g22210 pycom02g22360 pycom02g24960 pycom02g25680 pycom03g00220 pycom04g13360 pycom05g09060 pycom05g14220 pycom05g15180 pycom05g19710 pycom05g21810 pycom05g28580 pycom06g18880 pycom07g03710 pycom07g03870 pycom07g08310 pycom07g23160 pycom07g23200 pycom08g09480 pycom09g10710 pycom10g05060 pycom10g26630 pycom10g28210 pycom11g11050 pycom11g15130 pycom11g19210 pycom12g07930 pycom12g21370 pycom13g03500 pycom13g10600 pycom13g18700 pycom13g19700 pycom13g24060 pycom14g00430 pycom15g07010 pycom15g26870 pycom15g30340 pycom15g31320 pycom16g09070 pycom16g16170 pycom16g25330 pycom17g02990 pycom17g03830 pycom17g18350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	102
Acc65I	GGTACC	1 cut(s)	274
AccB1I	GGYRCC	1 cut(s)	274
AccII	CGCG	1 cut(s)	263
AciI	CCGC	2 cut(s)	42, 261
AcsI	RAATTY	2 cut(s)	160, 427
AfaI	GTAC	4 cut(s)	266, 276, 362, 373
AfiI	CCNNNNNNNGG	3 cut(s)	63, 221, 284
AflIII	ACRYGT	2 cut(s)	363, 374
AgsI	TTSAA	1 cut(s)	334
AjnI	CCWGG	1 cut(s)	137
AleI	CACNNNNGTG	1 cut(s)	120
AloI	GAACNNNNNNTCC	2 cut(s)	221, 253
AluBI	AGCT	1 cut(s)	190
AluI	AGCT	1 cut(s)	190
Alw26I	GTCTC	3 cut(s)	82, 372, 383
ApeKI	GCWGC	1 cut(s)	307
ApoI	RAATTY	2 cut(s)	160, 427
Asp718I	GGTACC	1 cut(s)	274
AspLEI	GCGC	2 cut(s)	212, 307
AspS9I	GGNCC	1 cut(s)	345
AsuHPI	GGTGA	2 cut(s)	156, 157
AvaII	GGWCC	1 cut(s)	345
AxyI	CCTNAGG	1 cut(s)	279
BanI	GGYRCC	1 cut(s)	274
BbvI	GCAGC	1 cut(s)	294
BccI	CCATC	2 cut(s)	57, 259
BciT130I	CCWGG	1 cut(s)	139
BcoDI	GTCTC	3 cut(s)	82, 372, 383
BisI	GCNGC	1 cut(s)	308
BlsI	GCNGC	1 cut(s)	309
Bme1390I	CCNGG	1 cut(s)	139
Bme18I	GGWCC	1 cut(s)	345
BmgT120I	GGNCC	1 cut(s)	345
BmiI	GGNNCC	2 cut(s)	276, 347
BmrFI	CCNGG	1 cut(s)	139
BmsI	GCATC	2 cut(s)	43, 292
BsaAI	YACGTR	1 cut(s)	364
BsaJI	CCNNGG	3 cut(s)	58, 138, 180
BsaXI	ACNNNNNCTCC	2 cut(s)	348, 378
Bsc4I	CCNNNNNNNGG	3 cut(s)	63, 221, 284
Bse21I	CCTNAGG	1 cut(s)	279
BseBI	CCWGG	1 cut(s)	139
BseDI	CCNNGG	3 cut(s)	58, 138, 180
BseGI	GGATG	4 cut(s)	11, 68, 251, 307
BseLI	CCNNNNNNNGG	3 cut(s)	63, 221, 284
BseRI	GAGGAG	1 cut(s)	369
BseXI	GCAGC	1 cut(s)	294
BsgI	GTGCAG	1 cut(s)	293
Bsh1236I	CGCG	1 cut(s)	263
BshNI	GGYRCC	1 cut(s)	274
BslFI	GGGAC	8 cut(s)	23, 28, 33, 162, 223, 237, 243, 331
BslI	CCNNNNNNNGG	3 cut(s)	63, 221, 284
BsmAI	GTCTC	3 cut(s)	82, 372, 383
BsmBI	CGTCTC	1 cut(s)	82
BsmFI	GGGAC	8 cut(s)	23, 28, 33, 162, 223, 237, 243, 331
BspACI	CCGC	2 cut(s)	42, 261
BspFNI	CGCG	1 cut(s)	263
BspLI	GGNNCC	2 cut(s)	276, 347
BspT107I	GGYRCC	1 cut(s)	274
BssECI	CCNNGG	3 cut(s)	58, 138, 180
Bst2UI	CCWGG	1 cut(s)	139
Bst4CI	ACNGT	2 cut(s)	274, 423
BstBAI	YACGTR	1 cut(s)	364
BstDEI	CTNAG	2 cut(s)	279, 296
BstDSI	CCRYGG	1 cut(s)	180
BstF5I	GGATG	4 cut(s)	11, 68, 251, 307
BstFNI	CGCG	1 cut(s)	263
BstHHI	GCGC	2 cut(s)	212, 307
BstMAI	GTCTC	3 cut(s)	82, 372, 383
BstNI	CCWGG	1 cut(s)	139
BstNSI	RCATGY	1 cut(s)	378
BstSCI	CCNGG	1 cut(s)	137
BstUI	CGCG	1 cut(s)	263
BstV1I	GCAGC	1 cut(s)	294
BstXI	CCANNNNNNTGG	1 cut(s)	122
Bsu36I	CCTNAGG	1 cut(s)	279
BtgI	CCRYGG	1 cut(s)	180
BtsCI	GGATG	4 cut(s)	11, 68, 251, 307
BtsIMutI	CAGTG	1 cut(s)	419
CfoI	GCGC	2 cut(s)	212, 307
Cfr13I	GGNCC	1 cut(s)	345
Csp6I	GTAC	4 cut(s)	265, 275, 361, 372
CviAII	CATG	1 cut(s)	375
CviJI	RGCY	1 cut(s)	190
CviKI_1	RGCY	1 cut(s)	190
CviQI	GTAC	4 cut(s)	265, 275, 361, 372
DdeI	CTNAG	2 cut(s)	279, 296
Eco47I	GGWCC	1 cut(s)	345
Eco81I	CCTNAGG	1 cut(s)	279
EcoO109I	RGGNCCY	1 cut(s)	345
EcoRII	CCWGG	1 cut(s)	137
Esp3I	CGTCTC	1 cut(s)	82
FaeI	CATG	1 cut(s)	378
FaiI	YATR	4 cut(s)	102, 376, 436, 438
FaqI	GGGAC	8 cut(s)	23, 28, 33, 162, 223, 237, 243, 331
FatI	CATG	1 cut(s)	374
FauI	CCCGC	2 cut(s)	35, 268
Fnu4HI	GCNGC	1 cut(s)	308
FokI	GGATG	4 cut(s)	18, 75, 238, 314
Fsp4HI	GCNGC	1 cut(s)	308
GlaI	GCGC	2 cut(s)	211, 306
GluI	GCNGC	1 cut(s)	308
HhaI	GCGC	2 cut(s)	212, 307
Hin1II	CATG	1 cut(s)	378
Hin6I	GCGC	2 cut(s)	210, 305
HinP1I	GCGC	2 cut(s)	210, 305
HinfI	GANTC	1 cut(s)	130
HphI	GGTGA	2 cut(s)	156, 157
Hpy166II	GTNNAC	1 cut(s)	397
Hpy188I	TCNGA	2 cut(s)	62, 322
Hpy8I	GTNNAC	1 cut(s)	397
HpyAV	CCTTC	1 cut(s)	78
HpyCH4III	ACNGT	2 cut(s)	274, 423
HpyCH4IV	ACGT	3 cut(s)	219, 363, 393
HpyCH4V	TGCA	1 cut(s)	310
HpyF3I	CTNAG	2 cut(s)	279, 296
HpySE526I	ACGT	3 cut(s)	219, 363, 393
Hsp92II	CATG	1 cut(s)	378
HspAI	GCGC	2 cut(s)	210, 305
KpnI	GGTACC	1 cut(s)	278
LmnI	GCTCC	1 cut(s)	45
LpnPI	CCDG	4 cut(s)	8, 124, 151, 362
Lsp1109I	GCAGC	1 cut(s)	294
LweI	GCATC	2 cut(s)	43, 292
MaeII	ACGT	3 cut(s)	219, 363, 393
MboII	GAAGA	2 cut(s)	90, 93
MluCI	AATT	4 cut(s)	103, 160, 388, 427
MlyI	GAGTC	1 cut(s)	139
MnlI	CCTC	5 cut(s)	68, 68, 321, 347, 350
MseI	TTAA	4 cut(s)	206, 405, 425, 431
MslI	CAYNNNNRTG	1 cut(s)	120
MspR9I	CCNGG	1 cut(s)	139
MvaI	CCWGG	1 cut(s)	139
MvnI	CGCG	1 cut(s)	263
NlaIII	CATG	1 cut(s)	378
NlaIV	GGNNCC	2 cut(s)	276, 347
NspI	RCATGY	1 cut(s)	378
OliI	CACNNNNGTG	1 cut(s)	120
PciI	ACATGT	1 cut(s)	374
PkrI	GCNGC	1 cut(s)	309
PleI	GAGTC	1 cut(s)	138
PpsI	GAGTC	1 cut(s)	138
Ppu21I	YACGTR	1 cut(s)	364
PpuMI	RGGWCCY	1 cut(s)	345
PscI	ACATGT	1 cut(s)	374
PsiI	TTATAA	1 cut(s)	102
Psp5II	RGGWCCY	1 cut(s)	345
Psp6I	CCWGG	1 cut(s)	137
PspGI	CCWGG	1 cut(s)	137
PspN4I	GGNNCC	2 cut(s)	276, 347
PspPI	GGNCC	1 cut(s)	345
PspPPI	RGGWCCY	1 cut(s)	345
RsaI	GTAC	4 cut(s)	266, 276, 362, 373
RsaNI	GTAC	4 cut(s)	265, 275, 361, 372
RseI	CAYNNNNRTG	1 cut(s)	120
SaqAI	TTAA	4 cut(s)	206, 405, 425, 431
SatI	GCNGC	1 cut(s)	308
Sau96I	GGNCC	1 cut(s)	345
SchI	GAGTC	1 cut(s)	139
ScrFI	CCNGG	1 cut(s)	139
SetI	ASST	9 cut(s)	192, 222, 236, 280, 315, 332, 347, 366, 396
SfaNI	GCATC	2 cut(s)	43, 292
SinI	GGWCC	1 cut(s)	345
SmiMI	CAYNNNNRTG	1 cut(s)	120
Sse9I	AATT	4 cut(s)	103, 160, 388, 427
SsiI	CCGC	2 cut(s)	42, 261
StyD4I	CCNGG	1 cut(s)	137
TaaI	ACNGT	2 cut(s)	274, 423
TaiI	ACGT	3 cut(s)	222, 366, 396
TasI	AATT	4 cut(s)	103, 160, 388, 427
Tru1I	TTAA	4 cut(s)	206, 405, 425, 431
Tru9I	TTAA	4 cut(s)	206, 405, 425, 431
TscAI	CASTG	1 cut(s)	426
TseI	GCWGC	1 cut(s)	307
TspGWI	ACGGA	4 cut(s)	42, 47, 106, 241
TspRI	CASTG	1 cut(s)	426
VpaK11BI	GGWCC	1 cut(s)	345
XapI	RAATTY	2 cut(s)	160, 427
XceI	RCATGY	1 cut(s)	378

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.