RchiOBHm_Chr5g0069181

SWIM zinc finger family protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
75118784 .. 75119144
361 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGTGGGTTGAGCGCAATAAGAAATCCATATTCATTCGTCAGGATACTTCAGAAACTGATTCTTTCATTCTGGGGATTCAGACTGAGTGGCAGCTGCAACAATTGATACGTTTTGGCCATCGCAGTCTCATTGCAATTGATTCAACATTTGGTATAAAGAGACTTAAGGTAACACATCCATTATGCTGCTTGATTTGTTCCATTATGCTGTTTCATAAACCAATTTTGTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

9.06

Weight (kDa)

9.35

Isoelectric Point (pI)

45.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 115
AcuI CTGAAG 1 cut(s) 33
AflII CTTAAG 1 cut(s) 164
AgsI TTSAA 1 cut(s) 144
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw26I GTCTC 2 cut(s) 131, 154
AlwNI CAGNNNCTG 1 cut(s) 56
AoxI GGCC 1 cut(s) 115
ApeKI GCWGC 3 cut(s) 91, 94, 186
AspLEI GCGC 1 cut(s) 15
BalI TGGCCA 1 cut(s) 117
BbvI GCAGC 3 cut(s) 81, 103, 173
BccI CCATC 1 cut(s) 126
BciVI GTATCC 1 cut(s) 37
BcoDI GTCTC 2 cut(s) 131, 154
BfrI CTTAAG 1 cut(s) 164
BfuI GTATCC 1 cut(s) 37
BisI GCNGC 3 cut(s) 92, 95, 187
BlsI GCNGC 3 cut(s) 93, 96, 188
Bse3DI GCAATG 1 cut(s) 129
BseGI GGATG 1 cut(s) 175
BseMI GCAATG 1 cut(s) 129
BseMII CTCAG 1 cut(s) 75
BseXI GCAGC 3 cut(s) 81, 103, 173
BshFI GGCC 1 cut(s) 117
BsmAI GTCTC 2 cut(s) 131, 154
BsnI GGCC 1 cut(s) 117
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 76
BspTI CTTAAG 1 cut(s) 164
BsrDI GCAATG 1 cut(s) 129
BstAFI CTTAAG 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 84
BstF5I GGATG 1 cut(s) 175
BstHHI GCGC 1 cut(s) 15
BstMAI GTCTC 2 cut(s) 131, 154
BstV1I GCAGC 3 cut(s) 81, 103, 173
BsuI GTATCC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 117
BtgZI GCGATG 1 cut(s) 104
BtsCI GGATG 1 cut(s) 175
CaiI CAGNNNCTG 1 cut(s) 56
CfoI GCGC 1 cut(s) 15
CviJI RGCY 2 cut(s) 94, 117
CviKI_1 RGCY 2 cut(s) 94, 117
DdeI CTNAG 1 cut(s) 84
EaeI YGGCCR 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 33
FaiI YATR 6 cut(s) 29, 155, 184, 206, 216, 232
Fnu4HI GCNGC 3 cut(s) 92, 95, 187
FokI GGATG 1 cut(s) 162
Fsp4HI GCNGC 3 cut(s) 92, 95, 187
GlaI GCGC 1 cut(s) 14
GluI GCNGC 3 cut(s) 92, 95, 187
HaeIII GGCC 1 cut(s) 117
HhaI GCGC 1 cut(s) 15
Hin6I GCGC 1 cut(s) 13
HinP1I GCGC 1 cut(s) 13
HinfI GANTC 3 cut(s) 59, 76, 140
Hpy188I TCNGA 2 cut(s) 52, 81
Hpy188III TCNNGA 1 cut(s) 41
HpyCH4IV ACGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 97, 134
HpyF3I CTNAG 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 109
HspAI GCGC 1 cut(s) 13
LpnPI CCDG 2 cut(s) 26, 56
Lsp1109I GCAGC 3 cut(s) 81, 103, 173
MaeII ACGT 1 cut(s) 109
MaeIII GTNAC 1 cut(s) 169
MfeI CAATTG 2 cut(s) 101, 135
MlsI TGGCCA 1 cut(s) 117
MluCI AATT 3 cut(s) 101, 135, 222
MluNI TGGCCA 1 cut(s) 117
Mox20I TGGCCA 1 cut(s) 117
MscI TGGCCA 1 cut(s) 117
MseI TTAA 1 cut(s) 165
Msp20I TGGCCA 1 cut(s) 117
MspA1I CMGCKG 1 cut(s) 94
MspCI CTTAAG 1 cut(s) 164
MunI CAATTG 2 cut(s) 101, 135
PfeI GAWTC 3 cut(s) 59, 76, 140
PkrI GCNGC 3 cut(s) 93, 96, 188
PstNI CAGNNNCTG 1 cut(s) 56
PvuII CAGCTG 1 cut(s) 94
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 3 cut(s) 92, 95, 187
SetI ASST 3 cut(s) 96, 112, 171
SgeI CNNG 3 cut(s) 53, 83, 202
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 3 cut(s) 101, 135, 222
TaiI ACGT 1 cut(s) 112
TasI AATT 3 cut(s) 101, 135, 222
TfiI GAWTC 3 cut(s) 59, 76, 140
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseI GCWGC 3 cut(s) 91, 94, 186
TspDTI ATGAA 3 cut(s) 22, 55, 203
Vha464I CTTAAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.