Rh5AG534600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000990
Physical Location & Seq
Reverse (-)
91746938 .. 91747670
733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG534600.1

Sequence Viewer

Length: 273 bp
ATGTGGGTGGAAAACCATCAGAATAGCATTTTCTTCTATGAGGATTTTTCTGAGACGTACCCTTTCACTTTGGGCATTCAAACAGACTGGCAACTGCAACAGATGATTCGCTTTGGCAATCACAGCCTTATAGCCTCTGATTCAAGGTTCGGAACAAACAAATTAAAGGAAAAAGTATGTGCTTTCAGGTTGGATATGATAAGCAGGTGGTCTGGGTCCTTGAAATCAATGCCTAATCTTGAAACTTCAAGATACTACTTCCTAGAACTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.77

Weight (kDa)

6.05

Isoelectric Point (pI)

39.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 195
Acc36I ACCTGC 1 cut(s) 195
AfaI GTAC 1 cut(s) 59
AgsI TTSAA 5 cut(s) 80, 144, 223, 242, 249
Alw26I GTCTC 1 cut(s) 47
AspS9I GGNCC 1 cut(s) 216
AvaII GGWCC 1 cut(s) 216
BccI CCATC 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 1 cut(s) 263
BfmI CTRYAG 1 cut(s) 269
BfuAI ACCTGC 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmiI GGNNCC 1 cut(s) 217
Bse1I ACTGG 1 cut(s) 92
BseMII CTCAG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 47
BsmBI CGTCTC 1 cut(s) 47
BsmI GAATGC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 217
BspMI ACCTGC 1 cut(s) 195
BsrI ACTGG 1 cut(s) 92
Bst4CI ACNGT 1 cut(s) 270
BstDEI CTNAG 1 cut(s) 51
BstMAI GTCTC 1 cut(s) 47
BstMWI GCNNNNNNNGC 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 269
BveI ACCTGC 1 cut(s) 195
Cfr13I GGNCC 1 cut(s) 216
Csp6I GTAC 1 cut(s) 58
CviJI RGCY 2 cut(s) 126, 134
CviKI_1 RGCY 2 cut(s) 126, 134
CviQI GTAC 1 cut(s) 58
DdeI CTNAG 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 216
EcoO109I RGGNCCY 1 cut(s) 216
Esp3I CGTCTC 1 cut(s) 47
FaiI YATR 4 cut(s) 39, 131, 178, 197
FspBI CTAG 1 cut(s) 263
HinfI GANTC 2 cut(s) 106, 140
Hpy188I TCNGA 4 cut(s) 21, 52, 139, 152
Hpy188III TCNNGA 2 cut(s) 239, 249
HpyCH4III ACNGT 1 cut(s) 270
HpyCH4IV ACGT 1 cut(s) 56
HpyCH4V TGCA 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 1 cut(s) 123
HpyF3I CTNAG 1 cut(s) 51
HpySE526I ACGT 1 cut(s) 56
LpnPI CCDG 4 cut(s) 73, 172, 190, 198
MaeI CTAG 1 cut(s) 263
MaeII ACGT 1 cut(s) 56
MboII GAAGA 1 cut(s) 25
MluCI AATT 1 cut(s) 161
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 2 cut(s) 34, 145
MseI TTAA 1 cut(s) 164
Mva1269I GAATGC 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 123
NlaIV GGNNCC 1 cut(s) 217
PaqCI CACCTGC 1 cut(s) 195
PctI GAATGC 1 cut(s) 75
PfeI GAWTC 2 cut(s) 106, 140
PpuMI RGGWCCY 1 cut(s) 216
Psp5II RGGWCCY 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 1 cut(s) 216
PspPPI RGGWCCY 1 cut(s) 216
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
SaqAI TTAA 1 cut(s) 164
Sau96I GGNCC 1 cut(s) 216
SetI ASST 4 cut(s) 59, 149, 191, 209
SfcI CTRYAG 1 cut(s) 269
SgeI CNNG 8 cut(s) 100, 156, 199, 217, 225, 232, 251, 261
SinI GGWCC 1 cut(s) 216
Sse9I AATT 1 cut(s) 161
SspMI CTAG 1 cut(s) 263
TaaI ACNGT 1 cut(s) 270
TaiI ACGT 1 cut(s) 59
TasI AATT 1 cut(s) 161
TfiI GAWTC 2 cut(s) 106, 140
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 216
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.