Rh5AG536500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000990
Physical Location & Seq
Reverse (-)
92178153 .. 92178508
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG536500.1

Sequence Viewer

Length: 249 bp
ATGAATTGCAAACCAAAGGTTGATGGCATCCTTGAATATATTCTATATTGGTGTTCTTTTGGTCCTGATGACCACAGGATGGGCGGCTCTATACGACCCAGTAGGACTAATTATGTCCCAAAGAAAAATTCTGGTCGACCAAACACCAAGAGAGGTTGTACCTGCCACTTTATGGTGAAACGCTTAATTGCTGAACCGTCAGTAGCGCTTCTTGTATATAATTCTGTTAAGCATGTGGATAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.35

Weight (kDa)

9.74

Isoelectric Point (pI)

31.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 170
AccB7I CCANNNNNTGG 2 cut(s) 79, 172
AccI GTMKAC 1 cut(s) 136
AciI CCGC 1 cut(s) 84
AcsI RAATTY 1 cut(s) 127
AfaI GTAC 1 cut(s) 160
AfeI AGCGCT 1 cut(s) 207
AfiI CCNNNNNNNGG 2 cut(s) 79, 172
AgsI TTSAA 1 cut(s) 35
AjuI GAANNNNNNNTTGG 2 cut(s) 112, 144
Aor51HI AGCGCT 1 cut(s) 207
ApoI RAATTY 1 cut(s) 127
Asp700I GAANNNNTTC 1 cut(s) 39
AspLEI GCGC 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 187
AvaII GGWCC 1 cut(s) 62
BccI CCATC 2 cut(s) 17, 73
BfoI RGCGCY 1 cut(s) 209
BfuAI ACCTGC 1 cut(s) 170
BisI GCNGC 1 cut(s) 85
BlsI GCNGC 1 cut(s) 86
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmrI ACTGGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 36
BmuI ACTGGG 1 cut(s) 93
Bsc4I CCNNNNNNNGG 2 cut(s) 79, 172
Bse1I ACTGG 1 cut(s) 99
BseGI GGATG 2 cut(s) 27, 84
BseLI CCNNNNNNNGG 2 cut(s) 79, 172
BseNI ACTGG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 101
BslI CCNNNNNNNGG 2 cut(s) 79, 172
BsmFI GGGAC 1 cut(s) 101
BspACI CCGC 1 cut(s) 84
BspMI ACCTGC 1 cut(s) 170
BsrI ACTGG 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 198
BstF5I GGATG 2 cut(s) 27, 84
BstH2I RGCGCY 1 cut(s) 209
BstHHI GCGC 1 cut(s) 208
BstNSI RCATGY 1 cut(s) 236
BtsCI GGATG 2 cut(s) 27, 84
BveI ACCTGC 1 cut(s) 170
CfoI GCGC 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 159
CviAII CATG 1 cut(s) 233
CviJI RGCY 1 cut(s) 87
CviKI_1 RGCY 1 cut(s) 87
CviQI GTAC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 62
Eco47III AGCGCT 1 cut(s) 207
FaeI CATG 1 cut(s) 236
FaiI YATR 8 cut(s) 39, 46, 92, 114, 173, 217, 219, 234
FaqI GGGAC 1 cut(s) 101
FatI CATG 1 cut(s) 232
FblI GTMKAC 1 cut(s) 136
Fnu4HI GCNGC 1 cut(s) 85
FokI GGATG 2 cut(s) 14, 91
Fsp4HI GCNGC 1 cut(s) 85
GlaI GCGC 1 cut(s) 207
GluI GCNGC 1 cut(s) 85
HaeII RGCGCY 1 cut(s) 209
HhaI GCGC 1 cut(s) 208
Hin1II CATG 1 cut(s) 236
Hin6I GCGC 1 cut(s) 206
HinP1I GCGC 1 cut(s) 206
HincII GTYRAC 1 cut(s) 137
HindII GTYRAC 1 cut(s) 137
HphI GGTGA 1 cut(s) 187
Hpy166II GTNNAC 1 cut(s) 137
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 198
HpyCH4V TGCA 1 cut(s) 9
Hsp92II CATG 1 cut(s) 236
HspAI GCGC 1 cut(s) 206
LpnPI CCDG 5 cut(s) 61, 78, 112, 117, 175
LweI GCATC 1 cut(s) 36
MluCI AATT 5 cut(s) 4, 109, 127, 186, 220
MnlI CCTC 1 cut(s) 146
MroXI GAANNNNTTC 1 cut(s) 39
MseI TTAA 2 cut(s) 185, 228
NlaIII CATG 1 cut(s) 236
NspI RCATGY 1 cut(s) 236
PdmI GAANNNNTTC 1 cut(s) 39
PflMI CCANNNNNTGG 2 cut(s) 79, 172
PkrI GCNGC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 62
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SalI GTCGAC 1 cut(s) 135
SaqAI TTAA 2 cut(s) 185, 228
SatI GCNGC 1 cut(s) 85
Sau96I GGNCC 1 cut(s) 62
SetI ASST 3 cut(s) 21, 157, 164
SfaNI GCATC 1 cut(s) 36
SgeI CNNG 9 cut(s) 44, 77, 88, 111, 144, 160, 174, 224, 245
SinI GGWCC 1 cut(s) 62
Sse9I AATT 5 cut(s) 4, 109, 127, 186, 220
SsiI CCGC 1 cut(s) 84
TaaI ACNGT 1 cut(s) 198
TaqI TCGA 1 cut(s) 136
TasI AATT 5 cut(s) 4, 109, 127, 186, 220
TauI GCSGC 1 cut(s) 87
Tru1I TTAA 2 cut(s) 185, 228
Tru9I TTAA 2 cut(s) 185, 228
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 2 cut(s) 79, 172
VpaK11BI GGWCC 1 cut(s) 62
XapI RAATTY 1 cut(s) 127
XceI RCATGY 1 cut(s) 236
XmiI GTMKAC 1 cut(s) 136
XmnI GAANNNNTTC 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.