RchiOBHm_Chr3g0481331

UBA-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
27370709 .. 27371005
297 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGTATGCTCCTGCCAATCTAATTGAATCTCCTGGTAATGGGCTTCCGGTTGAGAAAATTCCTGAAGAAAATTCAGATTTTGATCGTGCAGTTTCGTTGTCCTTGAAGGTTCTTAATCTGTCTTTCTTTTTCTGGGAGGTGGGTGCTTCCTTATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.76

Weight (kDa)

4.25

Isoelectric Point (pI)

50.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 57, 70
AcuI CTGAAG 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 2 cut(s) 26, 106
AjnI CCWGG 1 cut(s) 31
ApoI RAATTY 2 cut(s) 57, 70
BciT130I CCWGG 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BsaBI GATNNNNATC 1 cut(s) 81
BsaWI WCCGGW 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse8I GATNNNNATC 1 cut(s) 81
BseBI CCWGG 1 cut(s) 33
BseJI GATNNNNATC 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 38
BsgI GTGCAG 1 cut(s) 108
BsiSI CCGG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 38
Bsp143I GATC 1 cut(s) 82
BssMI GATC 1 cut(s) 82
Bst2UI CCWGG 1 cut(s) 33
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstNI CCWGG 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 31
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 31
FaiI YATR 1 cut(s) 6
HapII CCGG 1 cut(s) 47
HinfI GANTC 1 cut(s) 26
HpaII CCGG 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 62
HpyAV CCTTC 1 cut(s) 100
HpyCH4V TGCA 1 cut(s) 89
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 13
LpnPI CCDG 6 cut(s) 18, 24, 45, 60, 75, 118
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 77
MluCI AATT 3 cut(s) 21, 57, 70
MnlI CCTC 1 cut(s) 130
MseI TTAA 1 cut(s) 114
MspI CCGG 1 cut(s) 47
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
NdeII GATC 1 cut(s) 82
PfeI GAWTC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 1 cut(s) 82
ScrFI CCNGG 1 cut(s) 33
SetI ASST 2 cut(s) 111, 141
SgeI CNNG 8 cut(s) 23, 44, 45, 59, 74, 98, 115, 145
Sse9I AATT 3 cut(s) 21, 57, 70
StyD4I CCNGG 1 cut(s) 31
TasI AATT 3 cut(s) 21, 57, 70
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
XapI RAATTY 2 cut(s) 57, 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.