RchiOBHm_Chr1g0357621

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
49951351 .. 49953917
2567 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 543 bp
ATGAAGAAGGTTATTCTGAGATTGGATTTGCATGATGACAGAGCCAAGCAGAAGGCATTGAAGACAGTCTCTACTCTTTCAGGCATTGATTCCATCGCCATGGACATGAAGGAGAAGAAACTAACAGTGATCGGGTCGGTGGATCCAGTGAATGTGGTGAGCAAATTGCGCAAGTATTGGCCAACAGATATGATCTCAGTAGGGCCAGCAGTAGAGCCTAAGAAAGAGGAGCCAAAGAAGGAAGAAGCAAAGAAAGAAGAAGGAAAGAAGGAAGGAGAGGAAGCAAAGAAAGAAGGGGAAGAGGCGAAGAAGGAGGAACCCAAGAAAGAGGAGGAGAAGAAAGAAGGAGGAGGAGAGGAAGCTAAGAAAGAAGAGCCAAAGAAAGAGGAAGAGAAGAAAGAAGAAGAGAAGAAGAAAGAGGTTCCTCCTCCAGACCCCGTCTTAGAGCTTGTCAAGGCTTACAGAGCATACAACCCTCACATGACCACTTATTACCATGTGCAAAGCATTGAAGAGAATCCAAATGCTTGTGTTATTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

180

Amino Acids

20.53

Weight (kDa)

6.1

Isoelectric Point (pI)

54.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 9 - 58 1.7e-07 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 170
AclWI GGATC 2 cut(s) 137, 150
AcoI YGGCCR 1 cut(s) 179
AgsI TTSAA 2 cut(s) 61, 512
AluBI AGCT 2 cut(s) 362, 448
AluI AGCT 2 cut(s) 362, 448
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 2 cut(s) 137, 150
AoxI GGCC 2 cut(s) 179, 203
AspLEI GCGC 1 cut(s) 171
AspS9I GGNCC 1 cut(s) 203
AsuHPI GGTGA 1 cut(s) 169
BalI TGGCCA 1 cut(s) 181
BamHI GGATCC 1 cut(s) 142
BbsI GAAGAC 1 cut(s) 68
BccI CCATC 1 cut(s) 101
BcoDI GTCTC 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 203
BmiI GGNNCC 4 cut(s) 144, 231, 318, 423
BpiI GAAGAC 1 cut(s) 68
BpmI CTGGAG 1 cut(s) 414
BsaJI CCNNGG 1 cut(s) 99
Bse1I ACTGG 1 cut(s) 146
BseDI CCNNGG 1 cut(s) 99
BseMII CTCAG 2 cut(s) 8, 210
BseNI ACTGG 1 cut(s) 146
BseRI GAGGAG 6 cut(s) 242, 344, 347, 363, 366, 417
BshFI GGCC 2 cut(s) 181, 205
BsmAI GTCTC 1 cut(s) 73
BsnI GGCC 2 cut(s) 181, 205
Bsp143I GATC 3 cut(s) 129, 142, 192
Bsp19I CCATGG 1 cut(s) 99
BspANI GGCC 2 cut(s) 181, 205
BspCNI CTCAG 2 cut(s) 9, 209
BspLI GGNNCC 4 cut(s) 144, 231, 318, 423
BspPI GGATC 2 cut(s) 137, 150
BspQI GCTCTTC 1 cut(s) 366
BsrI ACTGG 1 cut(s) 146
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 3 cut(s) 129, 142, 192
BssT1I CCWWGG 1 cut(s) 99
Bst4CI ACNGT 2 cut(s) 67, 127
Bst6I CTCTTC 5 cut(s) 294, 366, 384, 399, 507
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 5 cut(s) 17, 196, 219, 363, 442
BstDSI CCRYGG 1 cut(s) 99
BstHHI GCGC 1 cut(s) 171
BstKTI GATC 3 cut(s) 132, 145, 195
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 3 cut(s) 129, 142, 192
BstMWI GCNNNNNNNGC 2 cut(s) 168, 464
BstV2I GAAGAC 1 cut(s) 68
BstX2I RGATCY 1 cut(s) 142
BstXI CCANNNNNNTGG 1 cut(s) 100
BstYI RGATCY 1 cut(s) 142
BsuRI GGCC 2 cut(s) 181, 205
BtgI CCRYGG 1 cut(s) 99
BtgZI GCGATG 1 cut(s) 79
BtsIMutI CAGTG 2 cut(s) 132, 153
Cac8I GCNNGC 1 cut(s) 207
CfoI GCGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 203
CviAII CATG 5 cut(s) 32, 100, 106, 481, 497
CviJI RGCY 9 cut(s) 44, 181, 205, 217, 232, 362, 376, 448, 458
CviKI_1 RGCY 9 cut(s) 44, 181, 205, 217, 232, 362, 376, 448, 458
DdeI CTNAG 5 cut(s) 17, 196, 219, 363, 442
DpnI GATC 3 cut(s) 131, 144, 194
DpnII GATC 3 cut(s) 129, 142, 192
EaeI YGGCCR 1 cut(s) 179
Eam1104I CTCTTC 5 cut(s) 294, 366, 384, 399, 507
EarI CTCTTC 5 cut(s) 294, 366, 384, 399, 507
Eco130I CCWWGG 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 5 cut(s) 35, 103, 109, 484, 500
FaiI YATR 7 cut(s) 33, 101, 107, 191, 469, 482, 498
FatI CATG 5 cut(s) 31, 99, 105, 480, 496
FspI TGCGCA 1 cut(s) 170
GlaI GCGC 1 cut(s) 170
GsuI CTGGAG 1 cut(s) 414
HaeIII GGCC 2 cut(s) 181, 205
HhaI GCGC 1 cut(s) 171
Hin1II CATG 5 cut(s) 35, 103, 109, 484, 500
Hin6I GCGC 1 cut(s) 169
HinP1I GCGC 1 cut(s) 169
HinfI GANTC 2 cut(s) 89, 517
HphI GGTGA 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 431
HpyAV CCTTC 9 cut(s) 46, 103, 232, 254, 262, 266, 287, 304, 338
HpyCH4III ACNGT 2 cut(s) 67, 127
HpyCH4V TGCA 2 cut(s) 31, 502
HpyF10VI GCNNNNNNNGC 2 cut(s) 168, 464
HpyF3I CTNAG 5 cut(s) 17, 196, 219, 363, 442
Hsp92II CATG 5 cut(s) 35, 103, 109, 484, 500
HspAI GCGC 1 cut(s) 169
Kzo9I GATC 3 cut(s) 129, 142, 192
LguI GCTCTTC 1 cut(s) 366
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 4 cut(s) 66, 159, 219, 444
MalI GATC 3 cut(s) 131, 144, 194
MboI GATC 3 cut(s) 129, 142, 192
MflI RGATCY 1 cut(s) 142
MlsI TGGCCA 1 cut(s) 181
MluCI AATT 1 cut(s) 164
MluNI TGGCCA 1 cut(s) 181
Mox20I TGGCCA 1 cut(s) 181
MscI TGGCCA 1 cut(s) 181
MslI CAYNNNNRTG 2 cut(s) 98, 104
Msp20I TGGCCA 1 cut(s) 181
MwoI GCNNNNNNNGC 2 cut(s) 168, 464
NcoI CCATGG 1 cut(s) 99
NdeII GATC 3 cut(s) 129, 142, 192
NlaIII CATG 5 cut(s) 35, 103, 109, 484, 500
NlaIV GGNNCC 4 cut(s) 144, 231, 318, 423
NsbI TGCGCA 1 cut(s) 170
PciSI GCTCTTC 1 cut(s) 366
PfeI GAWTC 2 cut(s) 89, 517
PflFI GACNNNGTC 1 cut(s) 437
PspN4I GGNNCC 4 cut(s) 144, 231, 318, 423
PspPI GGNCC 1 cut(s) 203
PsuI RGATCY 1 cut(s) 142
PsyI GACNNNGTC 1 cut(s) 437
RseI CAYNNNNRTG 2 cut(s) 98, 104
SapI GCTCTTC 1 cut(s) 366
Sau3AI GATC 3 cut(s) 129, 142, 192
Sau96I GGNCC 1 cut(s) 203
SetI ASST 4 cut(s) 12, 364, 423, 450
SmiMI CAYNNNNRTG 2 cut(s) 98, 104
Sse9I AATT 1 cut(s) 164
StyI CCWWGG 1 cut(s) 99
TaaI ACNGT 2 cut(s) 67, 127
TasI AATT 1 cut(s) 164
TfiI GAWTC 2 cut(s) 89, 517
TscAI CASTG 2 cut(s) 132, 153
TspDTI ATGAA 2 cut(s) 17, 122
TspRI CASTG 2 cut(s) 132, 153
Tth111I GACNNNGTC 1 cut(s) 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.