RchiOBHm_Chr1g0344671

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001848
Physical Location & Seq
Forward (+)
37017533 .. 37024345
6813 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57108

Sequence Viewer

Length: 285 bp
ATGCAAAAAGGTGTGCATATTGTTAAACTGTTGCTGTTCCTCTGTGCATCGTTTACCGTTATTCCAGTCTCCTGCTCTTATTCAGTTATTATGTGTTTGGAGGTGCTCTTCTGTTTAGATTTTTTGCACTGTAATCATGATGATGTTGCATGTAGTAATGTGTGTAGAATGATACAGATACAGAAGAAAAGAATACAAAACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTTCGTTTCCTAAGCATTCCCTGCTCCCCACAATACTTGATGTTGTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.68

Weight (kDa)

8.48

Isoelectric Point (pI)

32.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw21I GWGCWC 1 cut(s) 108
Alw26I GTCTC 1 cut(s) 73
Bbv12I GWGCWC 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 73
BmsI GCATC 1 cut(s) 56
Bpu10I CCTNAGC 1 cut(s) 245
Bse1I ACTGG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 65
BsiHKAI GWGCWC 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 249
Bsp1286I GDGCHC 1 cut(s) 108
BspHI TCATGA 1 cut(s) 136
BspQI GCTCTTC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 65
Bst4CI ACNGT 3 cut(s) 30, 58, 131
Bst6I CTCTTC 2 cut(s) 113, 240
BstAPI GCANNNNNTGC 1 cut(s) 255
BstDEI CTNAG 1 cut(s) 245
BstMAI GTCTC 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 255
BstNSI RCATGY 1 cut(s) 153
BtsIMutI CAGTG 1 cut(s) 127
CciI TCATGA 1 cut(s) 136
CspCI CAANNNNNGTGG 1 cut(s) 252
CviAII CATG 2 cut(s) 137, 150
DdeI CTNAG 1 cut(s) 245
Eam1104I CTCTTC 2 cut(s) 113, 240
EarI CTCTTC 2 cut(s) 113, 240
FaeI CATG 2 cut(s) 140, 153
FaiI YATR 5 cut(s) 18, 92, 138, 151, 283
FatI CATG 2 cut(s) 136, 149
Hin1II CATG 2 cut(s) 140, 153
Hpy166II GTNNAC 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 54
HpyCH4III ACNGT 3 cut(s) 30, 58, 131
HpyCH4V TGCA 5 cut(s) 4, 16, 47, 127, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 255
HpyF3I CTNAG 1 cut(s) 245
Hsp92II CATG 2 cut(s) 140, 153
LguI GCTCTTC 1 cut(s) 113
LmnI GCTCC 1 cut(s) 263
LpnPI CCDG 3 cut(s) 78, 85, 268
LweI GCATC 1 cut(s) 56
MboII GAAGA 3 cut(s) 100, 196, 227
MhlI GDGCHC 1 cut(s) 108
MnlI CCTC 2 cut(s) 50, 94
MseI TTAA 1 cut(s) 24
MslI CAYNNNNRTG 1 cut(s) 141
Mva1269I GAATGC 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 255
NlaIII CATG 2 cut(s) 140, 153
NspI RCATGY 1 cut(s) 153
PagI TCATGA 1 cut(s) 136
PciSI GCTCTTC 1 cut(s) 113
PctI GAATGC 1 cut(s) 249
RseI CAYNNNNRTG 1 cut(s) 141
SapI GCTCTTC 1 cut(s) 113
SaqAI TTAA 1 cut(s) 24
SduI GDGCHC 1 cut(s) 108
SetI ASST 2 cut(s) 13, 105
SfaNI GCATC 1 cut(s) 56
SgeI CNNG 5 cut(s) 77, 84, 149, 162, 267
SmiMI CAYNNNNRTG 1 cut(s) 141
TaaI ACNGT 3 cut(s) 30, 58, 131
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TscAI CASTG 1 cut(s) 134
TspRI CASTG 1 cut(s) 134
XceI RCATGY 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.