Rh4BG304400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001848
Physical Location & Seq
Reverse (-)
47472887 .. 47473160
274 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG304400.1

Sequence Viewer

Length: 159 bp
ATGGAAGAGGTCTGCGATGGTAATAGTTTTTCTGCCTCAGTAACTGAAGCTGAAAGGACTTTTTCTACTGGAGGAACAAATTCCAAAATTCGATCAAGAAGCTGGAAACAAACGTCTGAACCAGCAATCACAAAAAATAGTCAGCGTACTCAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.76

Weight (kDa)

9.1

Isoelectric Point (pI)

55.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 79, 87
AcuI CTGAAG 1 cut(s) 66
AfaI GTAC 1 cut(s) 148
AluBI AGCT 2 cut(s) 50, 102
AluI AGCT 2 cut(s) 50, 102
AlwNI CAGNNNCTG 1 cut(s) 44
ApoI RAATTY 2 cut(s) 79, 87
Asp700I GAANNNNTTC 1 cut(s) 79
BccI CCATC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 51
BseNI ACTGG 1 cut(s) 73
Bsp143I GATC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 50
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 92
BstDEI CTNAG 1 cut(s) 37
BstKTI GATC 1 cut(s) 95
BstMBI GATC 1 cut(s) 92
BtgZI GCGATG 1 cut(s) 30
CaiI CAGNNNCTG 1 cut(s) 44
Csp6I GTAC 1 cut(s) 147
CviJI RGCY 2 cut(s) 50, 102
CviKI_1 RGCY 2 cut(s) 50, 102
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 1 cut(s) 37
DpnI GATC 1 cut(s) 94
DpnII GATC 1 cut(s) 92
Eco57I CTGAAG 1 cut(s) 66
FspEI CC 8 cut(s) 3, 40, 49, 54, 57, 88, 97, 135
GsuI CTGGAG 1 cut(s) 90
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 96
HpyCH4IV ACGT 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 113
Kzo9I GATC 1 cut(s) 92
LpnPI CCDG 3 cut(s) 54, 88, 135
MaeII ACGT 1 cut(s) 113
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 94
MboI GATC 1 cut(s) 92
MboII GAAGA 1 cut(s) 17
MluCI AATT 2 cut(s) 79, 87
MnlI CCTC 2 cut(s) 46, 65
MroXI GAANNNNTTC 1 cut(s) 79
NdeII GATC 1 cut(s) 92
PdmI GAANNNNTTC 1 cut(s) 79
PstNI CAGNNNCTG 1 cut(s) 44
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
Sau3AI GATC 1 cut(s) 92
SetI ASST 4 cut(s) 12, 52, 104, 116
SgeI CNNG 4 cut(s) 81, 108, 115, 134
Sse9I AATT 2 cut(s) 79, 87
TaiI ACGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 91
TasI AATT 2 cut(s) 79, 87
XapI RAATTY 2 cut(s) 79, 87
XmnI GAANNNNTTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.