Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0001848

Physical Location & Seq

Genomic Coordinates Reverse (-)

1691870 .. 1695995

Gene Structure 4126 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00078350.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 195 bp

ATGGCTCCAAAGATGAGTTGGACAAGAAGTAAGAGATTGTTAGAGGAGTATGAAGATGAAAATCATAATGCTGAAAGGGAAGTCCAAGAAATATCTAATGACCAGAATGTAATTGGTGGTATATCTGAAACTGGAACCGCAGTTTCTGGTAGGGATGAAGACCATCAAATTCATCCAAGATCAAGGCGTGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

64

Amino Acids

7.42

Weight (kDa)

5.12

Isoelectric Point (pI)

76.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001848)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0344671 RchiOBHm_Chr2g0103891 RchiOBHm_Chr2g0125481 RchiOBHm_Chr2g0127991 RchiOBHm_Chr4g0404361 RchiOBHm_Chr6g0293921 RchiOBHm_Chr7g0183991 RchiOBHm_Chr7g0200701 RchiOBHm_Chr7g0203451 RchiOBHm_Chr7g0233851
rosa_laevigata	RLG00000009445
rosa_multiflora	Rmu_sc0001762.1_g000048 Rmu_ssc0000198.1_g000001
rosa_roxburghii	Rroxscaffold_176G00431470 Rroxscaffold_1G00006800 Rroxscaffold_1G00038540 Rroxscaffold_1G00072610 Rroxscaffold_2G00078350 Rroxscaffold_2G00079900 Rroxscaffold_2G00125220 Rroxscaffold_3G00246630 Rroxscaffold_4G00306170 Rroxscaffold_4G00314800 Rroxscaffold_4G00317460 Rroxscaffold_4G00319930 Rroxscaffold_5G00343110 Rroxscaffold_6G00395760 Rroxscaffold_6G00421380 Rroxscaffold_7G00160650
rosa_rugosa	Rorug01G0217800 Rorug03G0274300 Rorug04G0088400 Rorug05G0172900 Rorug07G0221500
rosa_samantha	Rh1BG311700 Rh1DG110800 Rh2AG655300 Rh2BG324100 Rh2BG414100 Rh2DG254900 Rh3DG077200 Rh4BG304400 Rh5DG244400 Rh7BG056200
rosa_wichuraiana	Rw1G008450 Rw2G032850 Rw4G008300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	138
AcsI	RAATTY	1 cut(s)	168
AlwNI	CAGNNNCTG	1 cut(s)	146
ApoI	RAATTY	1 cut(s)	168
BbsI	GAAGAC	1 cut(s)	165
BccI	CCATC	1 cut(s)	171
BmiI	GGNNCC	2 cut(s)	6, 136
BpiI	GAAGAC	1 cut(s)	165
BsaBI	GATNNNNATC	1 cut(s)	60
Bse1I	ACTGG	1 cut(s)	136
Bse8I	GATNNNNATC	1 cut(s)	60
BseGI	GGATG	2 cut(s)	160, 172
BseJI	GATNNNNATC	1 cut(s)	60
BseNI	ACTGG	1 cut(s)	136
BseRI	GAGGAG	1 cut(s)	59
Bsp143I	GATC	1 cut(s)	179
BspACI	CCGC	1 cut(s)	138
BspLI	GGNNCC	2 cut(s)	6, 136
BsrI	ACTGG	1 cut(s)	136
BssMI	GATC	1 cut(s)	179
BstF5I	GGATG	2 cut(s)	160, 172
BstKTI	GATC	1 cut(s)	182
BstMBI	GATC	1 cut(s)	179
BstV2I	GAAGAC	1 cut(s)	165
BtsCI	GGATG	2 cut(s)	160, 172
CaiI	CAGNNNCTG	1 cut(s)	146
CviJI	RGCY	1 cut(s)	5
CviKI_1	RGCY	1 cut(s)	5
DpnI	GATC	1 cut(s)	181
DpnII	GATC	1 cut(s)	179
FaiI	YATR	3 cut(s)	51, 66, 122
FokI	GGATG	2 cut(s)	159, 167
Hpy188I	TCNGA	1 cut(s)	127
Kzo9I	GATC	1 cut(s)	179
LmnI	GCTCC	1 cut(s)	10
LpnPI	CCDG	3 cut(s)	116, 117, 132
MalI	GATC	1 cut(s)	181
MboI	GATC	1 cut(s)	179
MboII	GAAGA	2 cut(s)	65, 170
MluCI	AATT	2 cut(s)	111, 168
MnlI	CCTC	1 cut(s)	37
NdeII	GATC	1 cut(s)	179
NlaIV	GGNNCC	2 cut(s)	6, 136
PspN4I	GGNNCC	2 cut(s)	6, 136
PstNI	CAGNNNCTG	1 cut(s)	146
Sau3AI	GATC	1 cut(s)	179
SgeI	CNNG	6 cut(s)	36, 98, 115, 144, 159, 189
Sse9I	AATT	2 cut(s)	111, 168
SsiI	CCGC	1 cut(s)	138
TasI	AATT	2 cut(s)	111, 168
TspDTI	ATGAA	4 cut(s)	66, 72, 161, 171
XapI	RAATTY	1 cut(s)	168
XcmI	CCANNNNNNNNNTGG	2 cut(s)	15, 110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.