RchiOBHm_Chr4g0404361

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
24139917 .. 24143846
3930 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37593

Sequence Viewer

Length: 168 bp
ATGCAAAAAAGTGTACGTATCATTGCAATGCCACTGTTCCTTGGTCTGCTGTTTATCGTTGTCTCCATCTTTTATTCTTATTCAGATTTTGGGAACAGTGTGCTGTCGGATAGTTTAATTTTCTGCAATTCAGCTTTTTGGACAACCTCCACAACTAATCATCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.22

Weight (kDa)

6.69

Isoelectric Point (pI)

15.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 15
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
Alw26I GTCTC 1 cut(s) 67
BccI CCATC 1 cut(s) 74
BcoDI GTCTC 1 cut(s) 67
BfaI CTAG 1 cut(s) 166
BsaAI YACGTR 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 40
Bse3DI GCAATG 2 cut(s) 21, 33
BseDI CCNNGG 1 cut(s) 40
BseMI GCAATG 2 cut(s) 21, 33
BsmAI GTCTC 1 cut(s) 67
BsrDI GCAATG 2 cut(s) 21, 33
BssECI CCNNGG 1 cut(s) 40
BssT1I CCWWGG 1 cut(s) 40
Bst4CI ACNGT 2 cut(s) 36, 98
BstBAI YACGTR 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 67
BstSNI TACGTA 1 cut(s) 17
BtsIMutI CAGTG 2 cut(s) 32, 103
Csp6I GTAC 1 cut(s) 14
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
CviQI GTAC 1 cut(s) 14
Eco105I TACGTA 1 cut(s) 17
Eco130I CCWWGG 1 cut(s) 40
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FspBI CTAG 1 cut(s) 166
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 2 cut(s) 85, 109
Hpy8I GTNNAC 1 cut(s) 14
HpyCH4III ACNGT 2 cut(s) 36, 98
HpyCH4IV ACGT 1 cut(s) 16
HpyCH4V TGCA 3 cut(s) 4, 26, 126
HpySE526I ACGT 1 cut(s) 16
MaeI CTAG 1 cut(s) 166
MaeII ACGT 1 cut(s) 16
MluCI AATT 2 cut(s) 117, 127
MmeI TCCRAC 1 cut(s) 87
MnlI CCTC 1 cut(s) 157
MseI TTAA 1 cut(s) 116
MslI CAYNNNNRTG 1 cut(s) 26
Ppu21I YACGTR 1 cut(s) 17
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 1 cut(s) 116
SetI ASST 3 cut(s) 19, 136, 149
SgeI CNNG 1 cut(s) 53
SmiMI CAYNNNNRTG 1 cut(s) 26
SnaBI TACGTA 1 cut(s) 17
Sse9I AATT 2 cut(s) 117, 127
SspMI CTAG 1 cut(s) 166
StyI CCWWGG 1 cut(s) 40
TaaI ACNGT 2 cut(s) 36, 98
TaiI ACGT 1 cut(s) 19
TasI AATT 2 cut(s) 117, 127
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TscAI CASTG 2 cut(s) 39, 103
TspRI CASTG 2 cut(s) 39, 103
XspI CTAG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.