Rroxscaffold_176G00431470

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000176
Physical Location & Seq
Reverse (-)
1152941 .. 1156849
3909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_176G00431470.1

Sequence Viewer

Length: 174 bp
ATGGCACCGAGAATCCAATGGACAAGAACAAAAAGGTTGTTAGAAGAAAATCATGATGAAGGTCAAGGTACTGAAAAAAGAATGGAAGAGGTCTGCGATGGTAATAGTTTTTCTGCCTCAGTAACTGAAGCTGAAAGGACTTTTTCTACTAGAGGAACAAATTCCAAAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.52

Weight (kDa)

5.75

Isoelectric Point (pI)

35.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AcsI RAATTY 2 cut(s) 160, 168
AcuI CTGAAG 1 cut(s) 147
AfaI GTAC 1 cut(s) 70
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
AlwNI CAGNNNCTG 1 cut(s) 125
ApoI RAATTY 2 cut(s) 160, 168
Asp700I GAANNNNTTC 1 cut(s) 160
BanI GGYRCC 1 cut(s) 4
BccI CCATC 1 cut(s) 92
BfaI CTAG 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 6
BseMII CTCAG 1 cut(s) 132
BshNI GGYRCC 1 cut(s) 4
BspCNI CTCAG 1 cut(s) 131
BspHI TCATGA 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 6
BspT107I GGYRCC 1 cut(s) 4
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 118
BtgZI GCGATG 1 cut(s) 111
CaiI CAGNNNCTG 1 cut(s) 125
CciI TCATGA 1 cut(s) 52
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 53
CviJI RGCY 1 cut(s) 131
CviKI_1 RGCY 1 cut(s) 131
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 1 cut(s) 118
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 147
FaeI CATG 1 cut(s) 56
FaiI YATR 1 cut(s) 54
FatI CATG 1 cut(s) 52
FspBI CTAG 1 cut(s) 150
Hin1II CATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 118
Hsp92II CATG 1 cut(s) 56
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 121
MboII GAAGA 2 cut(s) 56, 98
MluCI AATT 2 cut(s) 160, 168
MnlI CCTC 3 cut(s) 82, 127, 146
MroXI GAANNNNTTC 1 cut(s) 160
NlaIII CATG 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 6
PagI TCATGA 1 cut(s) 52
PdmI GAANNNNTTC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 6
PstNI CAGNNNCTG 1 cut(s) 125
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SetI ASST 5 cut(s) 38, 64, 70, 93, 133
SgeI CNNG 5 cut(s) 21, 36, 65, 77, 162
Sse9I AATT 2 cut(s) 160, 168
SspMI CTAG 1 cut(s) 150
TasI AATT 2 cut(s) 160, 168
TfiI GAWTC 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 72
XapI RAATTY 2 cut(s) 160, 168
XmnI GAANNNNTTC 1 cut(s) 160
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.