Rmu_sc0001762.1_g000048
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001762.1
Physical Location & Seq
Reverse (-)
199829 .. 200522
694 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001762.1_g000048.1.cds

Sequence Viewer

Length: 387 bp
atggctccaaagttgaggtggacaagaagtaagagattgttacaggagtatgaagatgaaaatcataatgctgaaagggaagtccaagaaatatctaatgaccagaatgtaattggtagtatatctgaaactggaaccgtagtttctggtagggacgaagaccatcaaattcaaccaagatcaaggcgtggggagatttcatacaatggttgcaagctagatcagttcattcctcaaaaaactccagcgtacataagccaacacgaccttcacgttagttcttcatttccatcatcaacatttgaagtcaaatttgctcatgcagatataatgctagaggttagcaggagagaaaaggaagcaagaactgttcctgatccttcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

128

Amino Acids

14.7

Weight (kDa)

5.72

Isoelectric Point (pI)

61.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 371
AcsI RAATTY 2 cut(s) 168, 311
AfaI GTAC 1 cut(s) 251
AgsI TTSAA 2 cut(s) 173, 305
AjuI GAANNNNNNNTTGG 2 cut(s) 252, 284
AluBI AGCT 1 cut(s) 217
AluI AGCT 1 cut(s) 217
AlwI GGATC 1 cut(s) 371
ApoI RAATTY 2 cut(s) 168, 311
BbsI GAAGAC 1 cut(s) 165
BccI CCATC 2 cut(s) 171, 298
BfaI CTAG 2 cut(s) 218, 335
BmiI GGNNCC 2 cut(s) 6, 136
BpiI GAAGAC 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 228
BsaBI GATNNNNATC 1 cut(s) 60
Bse1I ACTGG 1 cut(s) 136
Bse8I GATNNNNATC 1 cut(s) 60
BseJI GATNNNNATC 1 cut(s) 60
BseNI ACTGG 1 cut(s) 136
BslFI GGGAC 1 cut(s) 167
BsmFI GGGAC 1 cut(s) 167
Bsp143I GATC 3 cut(s) 179, 220, 376
BspLI GGNNCC 2 cut(s) 6, 136
BspPI GGATC 1 cut(s) 371
BsrI ACTGG 1 cut(s) 136
BssMI GATC 3 cut(s) 179, 220, 376
Bst4CI ACNGT 2 cut(s) 139, 370
BstC8I GCNNGC 1 cut(s) 215
BstKTI GATC 3 cut(s) 182, 223, 379
BstMBI GATC 3 cut(s) 179, 220, 376
BstV2I GAAGAC 1 cut(s) 165
Cac8I GCNNGC 1 cut(s) 215
Csp6I GTAC 1 cut(s) 250
CviAII CATG 1 cut(s) 320
CviJI RGCY 3 cut(s) 5, 217, 258
CviKI_1 RGCY 3 cut(s) 5, 217, 258
CviQI GTAC 1 cut(s) 250
DpnI GATC 3 cut(s) 181, 222, 378
DpnII GATC 3 cut(s) 179, 220, 376
FaeI CATG 1 cut(s) 323
FaiI YATR 7 cut(s) 51, 66, 122, 202, 254, 321, 329
FaqI GGGAC 1 cut(s) 167
FatI CATG 1 cut(s) 319
FspBI CTAG 2 cut(s) 218, 335
GsuI CTGGAG 1 cut(s) 228
Hin1II CATG 1 cut(s) 323
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 2 cut(s) 374, 384
Hpy8I GTNNAC 1 cut(s) 21
HpyAV CCTTC 1 cut(s) 278
HpyCH4III ACNGT 2 cut(s) 139, 370
HpyCH4IV ACGT 1 cut(s) 273
HpyCH4V TGCA 2 cut(s) 213, 323
HpySE526I ACGT 1 cut(s) 273
Hsp92II CATG 1 cut(s) 323
Kzo9I GATC 3 cut(s) 179, 220, 376
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 6 cut(s) 29, 116, 117, 132, 258, 331
MaeI CTAG 2 cut(s) 218, 335
MaeII ACGT 1 cut(s) 273
MaeIII GTNAC 1 cut(s) 39
MalI GATC 3 cut(s) 181, 222, 378
MboI GATC 3 cut(s) 179, 220, 376
MboII GAAGA 3 cut(s) 65, 170, 273
MluCI AATT 3 cut(s) 111, 168, 311
MnlI CCTC 3 cut(s) 9, 243, 331
NdeII GATC 3 cut(s) 179, 220, 376
NlaIII CATG 1 cut(s) 323
NlaIV GGNNCC 2 cut(s) 6, 136
PcsI WCGNNNNNNNCGW 1 cut(s) 270
PspN4I GGNNCC 2 cut(s) 6, 136
RsaI GTAC 1 cut(s) 251
RsaNI GTAC 1 cut(s) 250
Sau3AI GATC 3 cut(s) 179, 220, 376
SetI ASST 5 cut(s) 20, 219, 270, 276, 342
Sse9I AATT 3 cut(s) 111, 168, 311
SspMI CTAG 2 cut(s) 218, 335
TaaI ACNGT 2 cut(s) 139, 370
TaiI ACGT 1 cut(s) 276
TasI AATT 3 cut(s) 111, 168, 311
TspDTI ATGAA 5 cut(s) 66, 72, 189, 217, 273
XapI RAATTY 2 cut(s) 168, 311
XcmI CCANNNNNNNNNTGG 2 cut(s) 15, 110
XspI CTAG 2 cut(s) 218, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.