Rroxscaffold_2G00125220

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001848
Physical Location & Seq
Forward (+)
59824015 .. 59827838
3824 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00125220.1

Sequence Viewer

Length: 240 bp
ATGGCACCGAGAATCCAATGGACAAGAACAAAAAGGTTGTTAGAAGAAAATCATGATGAAGGTCAAGGTACTGAAAAAAGAATGGAAGAGGTCTGTGATGGTAATTGTTTTTCTGCCTCAGTAACTGAAGCTGAAAGGACTTTTTCTACTAGAGGAACAAATTCCAAAATTCGATCAAGAAGCTGGAAACAAACATTTGAACCAGCAATCACAAAAAATAGTCAGCGTACTCAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.19

Weight (kDa)

9.5

Isoelectric Point (pI)

52.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AcsI RAATTY 2 cut(s) 160, 168
AcuI CTGAAG 1 cut(s) 147
AfaI GTAC 2 cut(s) 70, 229
AgsI TTSAA 1 cut(s) 200
AluBI AGCT 2 cut(s) 131, 183
AluI AGCT 2 cut(s) 131, 183
AlwNI CAGNNNCTG 1 cut(s) 125
ApoI RAATTY 2 cut(s) 160, 168
Asp700I GAANNNNTTC 1 cut(s) 160
BanI GGYRCC 1 cut(s) 4
BccI CCATC 1 cut(s) 92
BfaI CTAG 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 6
BseMII CTCAG 1 cut(s) 132
BshNI GGYRCC 1 cut(s) 4
Bsp143I GATC 1 cut(s) 173
BspCNI CTCAG 1 cut(s) 131
BspHI TCATGA 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 6
BspT107I GGYRCC 1 cut(s) 4
BssMI GATC 1 cut(s) 173
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 118
BstKTI GATC 1 cut(s) 176
BstMBI GATC 1 cut(s) 173
CaiI CAGNNNCTG 1 cut(s) 125
CciI TCATGA 1 cut(s) 52
Csp6I GTAC 2 cut(s) 69, 228
CviAII CATG 1 cut(s) 53
CviJI RGCY 2 cut(s) 131, 183
CviKI_1 RGCY 2 cut(s) 131, 183
CviQI GTAC 2 cut(s) 69, 228
DdeI CTNAG 1 cut(s) 118
DpnI GATC 1 cut(s) 175
DpnII GATC 1 cut(s) 173
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 147
FaeI CATG 1 cut(s) 56
FaiI YATR 1 cut(s) 54
FatI CATG 1 cut(s) 52
FspBI CTAG 1 cut(s) 150
Hin1II CATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 12
Hpy188III TCNNGA 2 cut(s) 53, 177
HpyAV CCTTC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 118
Hsp92II CATG 1 cut(s) 56
Kzo9I GATC 1 cut(s) 173
LpnPI CCDG 2 cut(s) 169, 216
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 121
MalI GATC 1 cut(s) 175
MboI GATC 1 cut(s) 173
MboII GAAGA 2 cut(s) 56, 98
MluCI AATT 3 cut(s) 103, 160, 168
MnlI CCTC 3 cut(s) 82, 127, 146
MroXI GAANNNNTTC 1 cut(s) 160
NdeII GATC 1 cut(s) 173
NlaIII CATG 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 6
PagI TCATGA 1 cut(s) 52
PdmI GAANNNNTTC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 6
PstNI CAGNNNCTG 1 cut(s) 125
RsaI GTAC 2 cut(s) 70, 229
RsaNI GTAC 2 cut(s) 69, 228
Sau3AI GATC 1 cut(s) 173
SetI ASST 6 cut(s) 38, 64, 70, 93, 133, 185
SgeI CNNG 8 cut(s) 21, 36, 65, 77, 162, 189, 196, 215
Sse9I AATT 3 cut(s) 103, 160, 168
SspMI CTAG 1 cut(s) 150
TaqI TCGA 1 cut(s) 172
TasI AATT 3 cut(s) 103, 160, 168
TfiI GAWTC 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 72
XapI RAATTY 2 cut(s) 160, 168
XmnI GAANNNNTTC 1 cut(s) 160
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.