Rroxscaffold_7G00160650

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001848
Physical Location & Seq
Forward (+)
3597232 .. 3603734
6503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00160650.1

Sequence Viewer

Length: 402 bp
ATGCAAAACCGTTTACACATCGTTCTGCTGCCACTGTTCCTTTGTGTATTGGTTAACACTATCTTGATCTCTCATTCTTATTTAGATTGTTGGAACAGTGTGCAGTCAGATTGTTTAACTGCTTTGAATTCAGTTATGGCTCCAAAGATGAGGTGGACAAGAAGTAAGAGATTGTTACAGGAGTATGAAGATGAAAATCATAATGCTGAAAGGGAAGTCCAAGAAATATCTAATGACCAGAATGTAATTGGTAATATATCTGAATCTGGAACCGCAGTTTCTGGTAGGGACGAAGACCATCAAATTCATCCAAGATCAAGGCATGCATCTGAGTTGAGGATGAGAAAAAGGGACCGACATTTAGACACTCAGTACAGTGCCAGGAATGATGATGCCAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

15.44

Weight (kDa)

6.14

Isoelectric Point (pI)

60.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 273
AcsI RAATTY 2 cut(s) 127, 303
AfaI GTAC 1 cut(s) 374
AgsI TTSAA 1 cut(s) 127
AjnI CCWGG 1 cut(s) 380
AlwNI CAGNNNCTG 1 cut(s) 281
ApeKI GCWGC 1 cut(s) 28
ApoI RAATTY 2 cut(s) 127, 303
AspS9I GGNCC 1 cut(s) 352
AvaII GGWCC 1 cut(s) 352
BbsI GAAGAC 1 cut(s) 300
BbvI GCAGC 1 cut(s) 15
BccI CCATC 1 cut(s) 306
BciT130I CCWGG 1 cut(s) 382
BisI GCNGC 1 cut(s) 29
BlsI GCNGC 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 382
Bme18I GGWCC 1 cut(s) 352
BmgT120I GGNCC 1 cut(s) 352
BmiI GGNNCC 3 cut(s) 141, 271, 353
BmrFI CCNGG 1 cut(s) 382
BmsI GCATC 2 cut(s) 335, 382
BpiI GAAGAC 1 cut(s) 300
BsaBI GATNNNNATC 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 396
Bse8I GATNNNNATC 1 cut(s) 195
BseBI CCWGG 1 cut(s) 382
BseGI GGATG 2 cut(s) 307, 345
BseJI GATNNNNATC 1 cut(s) 195
BseMII CTCAG 2 cut(s) 321, 383
BseNI ACTGG 1 cut(s) 396
BseXI GCAGC 1 cut(s) 15
BsgI GTGCAG 1 cut(s) 122
BslFI GGGAC 2 cut(s) 302, 365
BsmFI GGGAC 2 cut(s) 302, 365
Bsp143I GATC 2 cut(s) 66, 314
BspACI CCGC 1 cut(s) 273
BspCNI CTCAG 2 cut(s) 322, 382
BspLI GGNNCC 3 cut(s) 141, 271, 353
BsrI ACTGG 1 cut(s) 396
BssMI GATC 2 cut(s) 66, 314
Bst2UI CCWGG 1 cut(s) 382
Bst4CI ACNGT 4 cut(s) 11, 36, 98, 377
BstC8I GCNNGC 1 cut(s) 324
BstDEI CTNAG 2 cut(s) 330, 369
BstF5I GGATG 2 cut(s) 307, 345
BstKTI GATC 2 cut(s) 69, 317
BstMBI GATC 2 cut(s) 66, 314
BstNI CCWGG 1 cut(s) 382
BstNSI RCATGY 1 cut(s) 326
BstSCI CCNGG 1 cut(s) 380
BstV1I GCAGC 1 cut(s) 15
BstV2I GAAGAC 1 cut(s) 300
BtsCI GGATG 2 cut(s) 307, 345
BtsIMutI CAGTG 3 cut(s) 32, 103, 382
Cac8I GCNNGC 1 cut(s) 324
CaiI CAGNNNCTG 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 352
Csp6I GTAC 1 cut(s) 373
CviAII CATG 1 cut(s) 323
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
CviQI GTAC 1 cut(s) 373
DdeI CTNAG 2 cut(s) 330, 369
DpnI GATC 2 cut(s) 68, 316
DpnII GATC 2 cut(s) 66, 314
Eco47I GGWCC 1 cut(s) 352
EcoRI GAATTC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 380
EcoT22I ATGCAT 1 cut(s) 328
FaeI CATG 1 cut(s) 326
FaiI YATR 5 cut(s) 137, 186, 201, 257, 324
FaqI GGGAC 2 cut(s) 302, 365
FatI CATG 1 cut(s) 322
Fnu4HI GCNGC 1 cut(s) 29
FokI GGATG 2 cut(s) 294, 352
Fsp4HI GCNGC 1 cut(s) 29
GluI GCNGC 1 cut(s) 29
Hin1II CATG 1 cut(s) 326
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 1 cut(s) 263
HpaI GTTAAC 1 cut(s) 55
Hpy166II GTNNAC 3 cut(s) 14, 55, 156
Hpy188I TCNGA 3 cut(s) 109, 262, 331
Hpy188III TCNNGA 2 cut(s) 64, 267
Hpy8I GTNNAC 3 cut(s) 14, 55, 156
HpyCH4III ACNGT 4 cut(s) 11, 36, 98, 377
HpyCH4V TGCA 3 cut(s) 4, 103, 326
HpyF3I CTNAG 2 cut(s) 330, 369
Hsp92II CATG 1 cut(s) 326
KspAI GTTAAC 1 cut(s) 55
Kzo9I GATC 2 cut(s) 66, 314
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 6 cut(s) 164, 251, 252, 267, 367, 394
Lsp1109I GCAGC 1 cut(s) 15
LweI GCATC 2 cut(s) 335, 382
MaeIII GTNAC 1 cut(s) 174
MalI GATC 2 cut(s) 68, 316
MboI GATC 2 cut(s) 66, 314
MboII GAAGA 2 cut(s) 200, 305
MluCI AATT 3 cut(s) 127, 246, 303
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 2 cut(s) 144, 330
Mph1103I ATGCAT 1 cut(s) 328
MseI TTAA 2 cut(s) 54, 116
MspR9I CCNGG 1 cut(s) 382
MvaI CCWGG 1 cut(s) 382
NdeII GATC 2 cut(s) 66, 314
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 3 cut(s) 141, 271, 353
NsiI ATGCAT 1 cut(s) 328
NspI RCATGY 1 cut(s) 326
PaeI GCATGC 1 cut(s) 326
PfeI GAWTC 1 cut(s) 263
PkrI GCNGC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 380
PspGI CCWGG 1 cut(s) 380
PspN4I GGNNCC 3 cut(s) 141, 271, 353
PspPI GGNCC 1 cut(s) 352
PstNI CAGNNNCTG 1 cut(s) 281
RsaI GTAC 1 cut(s) 374
RsaNI GTAC 1 cut(s) 373
SaqAI TTAA 2 cut(s) 54, 116
SatI GCNGC 1 cut(s) 29
Sau3AI GATC 2 cut(s) 66, 314
Sau96I GGNCC 1 cut(s) 352
ScrFI CCNGG 1 cut(s) 382
SetI ASST 1 cut(s) 155
SfaNI GCATC 2 cut(s) 335, 382
SinI GGWCC 1 cut(s) 352
SphI GCATGC 1 cut(s) 326
Sse9I AATT 3 cut(s) 127, 246, 303
SsiI CCGC 1 cut(s) 273
StyD4I CCNGG 1 cut(s) 380
TaaI ACNGT 4 cut(s) 11, 36, 98, 377
TaqII GACCGA 1 cut(s) 369
TasI AATT 3 cut(s) 127, 246, 303
TatI WGTACW 1 cut(s) 372
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 2 cut(s) 54, 116
Tru9I TTAA 2 cut(s) 54, 116
TscAI CASTG 3 cut(s) 39, 103, 382
TseI GCWGC 1 cut(s) 28
TspDTI ATGAA 3 cut(s) 201, 207, 296
TspRI CASTG 3 cut(s) 39, 103, 382
VpaK11BI GGWCC 1 cut(s) 352
XapI RAATTY 2 cut(s) 127, 303
XceI RCATGY 1 cut(s) 326
XcmI CCANNNNNNNNNTGG 2 cut(s) 150, 245
Zsp2I ATGCAT 1 cut(s) 328
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.