Rroxscaffold_4G00314800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0001848
Physical Location & Seq
Reverse (-)
38957556 .. 38968485
10930 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00314800.1

Sequence Viewer

Length: 318 bp
CTGTTCCTTGGTCTGCTGTTTAGCATTCTCTCCATCTTTTATTCTTATTCAGATTTTGGGAACAGTGTGCTGTCGGACAGTTTAATTGTCTGCAATTCAGAAGAAAAGAAAAGAAGAAGAAGCAGAAAAGAAGAAGAAGAAAAAGGAGAAGGAGAAGGAGAAGAAGAGGAAGAAAAAGAAGAGGGAAACGGGAAGAATTTCACCGTTATTCAAGTCAGCACGGGTGTATGTTCGAATTTCACTGCTATTGAGCTTTTATTTAATTCAATTGAATTCAAATCAATAAACATGTTCTTATTTTTCCCTTTTTTTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

12.04

Weight (kDa)

4.56

Isoelectric Point (pI)

64.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 196, 235, 272
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 4 cut(s) 212, 267, 272, 277
AluBI AGCT 1 cut(s) 253
AluI AGCT 1 cut(s) 253
ApoI RAATTY 3 cut(s) 196, 235, 272
Asp700I GAANNNNTTC 1 cut(s) 197
AsuHPI GGTGA 1 cut(s) 193
AsuII TTCGAA 1 cut(s) 233
BccI CCATC 1 cut(s) 41
Bpu14I TTCGAA 1 cut(s) 233
BsaJI CCNNGG 1 cut(s) 7
BseDI CCNNGG 1 cut(s) 7
BsmI GAATGC 1 cut(s) 24
Bsp119I TTCGAA 1 cut(s) 233
BspT104I TTCGAA 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 7
Bst4CI ACNGT 3 cut(s) 65, 80, 205
Bst6I CTCTTC 2 cut(s) 159, 174
BstBI TTCGAA 1 cut(s) 233
BstNSI RCATGY 1 cut(s) 292
BtsI GCAGTG 1 cut(s) 240
BtsIMutI CAGTG 2 cut(s) 70, 240
CviAII CATG 1 cut(s) 289
CviJI RGCY 1 cut(s) 253
CviKI_1 RGCY 1 cut(s) 253
Eam1104I CTCTTC 2 cut(s) 159, 174
EarI CTCTTC 2 cut(s) 159, 174
Eco130I CCWWGG 1 cut(s) 7
EcoRI GAATTC 1 cut(s) 272
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 1 cut(s) 292
FaiI YATR 2 cut(s) 229, 290
FatI CATG 1 cut(s) 288
Hin1II CATG 1 cut(s) 292
HphI GGTGA 1 cut(s) 193
Hpy188I TCNGA 3 cut(s) 52, 76, 100
HpyAV CCTTC 2 cut(s) 143, 149
HpyCH4III ACNGT 3 cut(s) 65, 80, 205
HpyCH4V TGCA 1 cut(s) 93
Hsp92II CATG 1 cut(s) 292
MfeI CAATTG 1 cut(s) 267
MluCI AATT 7 cut(s) 84, 94, 196, 235, 262, 267, 272
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 2 cut(s) 160, 175
MroXI GAANNNNTTC 1 cut(s) 197
MseI TTAA 2 cut(s) 83, 261
MunI CAATTG 1 cut(s) 267
Mva1269I GAATGC 1 cut(s) 24
NlaIII CATG 1 cut(s) 292
NspI RCATGY 1 cut(s) 292
NspV TTCGAA 1 cut(s) 233
PciI ACATGT 1 cut(s) 288
PctI GAATGC 1 cut(s) 24
PdmI GAANNNNTTC 1 cut(s) 197
PscI ACATGT 1 cut(s) 288
SaqAI TTAA 2 cut(s) 83, 261
SetI ASST 1 cut(s) 255
SfuI TTCGAA 1 cut(s) 233
SgeI CNNG 6 cut(s) 20, 202, 224, 232, 234, 301
Sse9I AATT 7 cut(s) 84, 94, 196, 235, 262, 267, 272
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 3 cut(s) 65, 80, 205
TaqI TCGA 1 cut(s) 233
TasI AATT 7 cut(s) 84, 94, 196, 235, 262, 267, 272
Tru1I TTAA 2 cut(s) 83, 261
Tru9I TTAA 2 cut(s) 83, 261
TscAI CASTG 2 cut(s) 70, 247
TspRI CASTG 2 cut(s) 70, 247
XapI RAATTY 3 cut(s) 196, 235, 272
XceI RCATGY 1 cut(s) 292
XmnI GAANNNNTTC 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.