Rorug04G0088400

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
13720491 .. 13721161
671 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0088400.1

Sequence Viewer

Length: 213 bp
ATGGATATTATGAAGCATATTGGTGAGGGTGGCGTCCTGGCGAGGTCTTGGCCAGCTTCAACCATGATGAGAATCAAAGTGGAAGGTGATTCAAAATTGCTTATTGACTGTAATAATAATAAGATTGATATTCCTTGGCGTATATGTTTTCTTGTCCATGATATCAAACATCTGGCTCTTCAGTTCCAGGATATTGAGTTCAAACACATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.13

Weight (kDa)

6.89

Isoelectric Point (pI)

40.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 164
AcyI GRCGYC 1 cut(s) 33
AgsI TTSAA 3 cut(s) 60, 93, 202
AjnI CCWGG 2 cut(s) 36, 186
AloI GAACNNNNNNTCC 1 cut(s) 182
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AoxI GGCC 1 cut(s) 50
AsuHPI GGTGA 2 cut(s) 35, 98
BalI TGGCCA 1 cut(s) 52
BciT130I CCWGG 2 cut(s) 38, 188
BfaI CTAG 1 cut(s) 211
Bme1390I CCNGG 2 cut(s) 38, 188
BmrFI CCNGG 2 cut(s) 38, 188
BsaBI GATNNNNATC 1 cut(s) 71
BsaHI GRCGYC 1 cut(s) 33
BsaJI CCNNGG 1 cut(s) 134
Bse8I GATNNNNATC 1 cut(s) 71
BseBI CCWGG 2 cut(s) 38, 188
BseDI CCNNGG 1 cut(s) 134
BseJI GATNNNNATC 1 cut(s) 71
BshFI GGCC 1 cut(s) 52
BsnI GGCC 1 cut(s) 52
BspANI GGCC 1 cut(s) 52
BspQI GCTCTTC 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 134
BssNI GRCGYC 1 cut(s) 33
BssT1I CCWWGG 1 cut(s) 134
Bst2UI CCWGG 2 cut(s) 38, 188
Bst4CI ACNGT 1 cut(s) 110
Bst6I CTCTTC 1 cut(s) 183
BstACI GRCGYC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 54
BstNI CCWGG 2 cut(s) 38, 188
BstSCI CCNGG 2 cut(s) 36, 186
BsuRI GGCC 1 cut(s) 52
Cac8I GCNNGC 1 cut(s) 54
CseI GACGC 1 cut(s) 22
CviAII CATG 2 cut(s) 64, 158
CviJI RGCY 3 cut(s) 52, 56, 176
CviKI_1 RGCY 3 cut(s) 52, 56, 176
EaeI YGGCCR 1 cut(s) 50
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 134
Eco32I GATATC 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 164
EcoRII CCWGG 2 cut(s) 36, 186
EcoRV GATATC 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 134
FaeI CATG 2 cut(s) 67, 161
FaiI YATR 6 cut(s) 11, 18, 65, 143, 145, 159
FatI CATG 2 cut(s) 63, 157
FspBI CTAG 1 cut(s) 211
HaeIII GGCC 1 cut(s) 52
HgaI GACGC 1 cut(s) 22
Hin1I GRCGYC 1 cut(s) 33
Hin1II CATG 2 cut(s) 67, 161
HinfI GANTC 2 cut(s) 72, 89
HphI GGTGA 2 cut(s) 35, 98
HpyAV CCTTC 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 110
Hsp92I GRCGYC 1 cut(s) 33
Hsp92II CATG 2 cut(s) 67, 161
LguI GCTCTTC 1 cut(s) 183
LpnPI CCDG 6 cut(s) 23, 50, 66, 158, 173, 200
MaeI CTAG 1 cut(s) 211
MboII GAAGA 1 cut(s) 170
MlsI TGGCCA 1 cut(s) 52
MluCI AATT 1 cut(s) 95
MluNI TGGCCA 1 cut(s) 52
MnlI CCTC 2 cut(s) 19, 36
Mox20I TGGCCA 1 cut(s) 52
MscI TGGCCA 1 cut(s) 52
MslI CAYNNNNRTG 1 cut(s) 21
Msp20I TGGCCA 1 cut(s) 52
MspR9I CCNGG 2 cut(s) 38, 188
MvaI CCWGG 2 cut(s) 38, 188
NlaIII CATG 2 cut(s) 67, 161
PciSI GCTCTTC 1 cut(s) 183
PfeI GAWTC 2 cut(s) 72, 89
PfoI TCCNGGA 1 cut(s) 186
Psp6I CCWGG 2 cut(s) 36, 186
PspGI CCWGG 2 cut(s) 36, 186
RseI CAYNNNNRTG 1 cut(s) 21
SapI GCTCTTC 1 cut(s) 183
ScrFI CCNGG 2 cut(s) 38, 188
SetI ASST 3 cut(s) 47, 58, 88
SmiMI CAYNNNNRTG 1 cut(s) 21
Sse9I AATT 1 cut(s) 95
SspMI CTAG 1 cut(s) 211
StyD4I CCNGG 2 cut(s) 36, 186
StyI CCWWGG 1 cut(s) 134
TaaI ACNGT 1 cut(s) 110
TasI AATT 1 cut(s) 95
TfiI GAWTC 2 cut(s) 72, 89
TspDTI ATGAA 1 cut(s) 26
XspI CTAG 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.