Rroxscaffold_6G00421380

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
42555317 .. 42561605
6289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00421380.1

Sequence Viewer

Length: 246 bp
ATGCAAAACCGTTTACACATCGTTCTGCTGCCACTGTTCCTTTGTGTATTGGTTAACACTATCTTGATCTCTCATTCTTATTTAGATTGTTGGAACAGTGTGCAGTCAGATTGTTTAACTGCTTTGAATTCAGTTATGGCTCCAAAGATGAGGTGGACAAGAAGTAAGAGATTGTTACAGGAGTATGAAGATGAAAATCATAATGCTGAAAGGAAGTCCAAGAAATATCTAATGACCAGAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.64

Weight (kDa)

9.22

Isoelectric Point (pI)

60.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 127
AgsI TTSAA 1 cut(s) 127
ApeKI GCWGC 1 cut(s) 28
ApoI RAATTY 1 cut(s) 127
BbvI GCAGC 1 cut(s) 15
BisI GCNGC 1 cut(s) 29
BlsI GCNGC 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 141
BsaBI GATNNNNATC 1 cut(s) 195
Bse8I GATNNNNATC 1 cut(s) 195
BseJI GATNNNNATC 1 cut(s) 195
BseXI GCAGC 1 cut(s) 15
BsgI GTGCAG 1 cut(s) 122
Bsp143I GATC 1 cut(s) 66
BspLI GGNNCC 1 cut(s) 141
BssMI GATC 1 cut(s) 66
Bst4CI ACNGT 3 cut(s) 11, 36, 98
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstV1I GCAGC 1 cut(s) 15
BtsIMutI CAGTG 2 cut(s) 32, 103
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 127
FaiI YATR 3 cut(s) 137, 186, 201
Fnu4HI GCNGC 1 cut(s) 29
Fsp4HI GCNGC 1 cut(s) 29
GluI GCNGC 1 cut(s) 29
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HpaI GTTAAC 1 cut(s) 55
Hpy166II GTNNAC 3 cut(s) 14, 55, 156
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 64
Hpy8I GTNNAC 3 cut(s) 14, 55, 156
HpyCH4III ACNGT 3 cut(s) 11, 36, 98
HpyCH4V TGCA 2 cut(s) 4, 103
KspAI GTTAAC 1 cut(s) 55
Kzo9I GATC 1 cut(s) 66
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 164
Lsp1109I GCAGC 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 174
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MboII GAAGA 1 cut(s) 200
MluCI AATT 1 cut(s) 127
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 1 cut(s) 144
MseI TTAA 2 cut(s) 54, 116
NdeII GATC 1 cut(s) 66
NlaIV GGNNCC 1 cut(s) 141
PkrI GCNGC 1 cut(s) 30
PspN4I GGNNCC 1 cut(s) 141
SaqAI TTAA 2 cut(s) 54, 116
SatI GCNGC 1 cut(s) 29
Sau3AI GATC 1 cut(s) 66
SetI ASST 1 cut(s) 155
SgeI CNNG 4 cut(s) 76, 171, 191, 232
Sse9I AATT 1 cut(s) 127
TaaI ACNGT 3 cut(s) 11, 36, 98
TasI AATT 1 cut(s) 127
Tru1I TTAA 2 cut(s) 54, 116
Tru9I TTAA 2 cut(s) 54, 116
TscAI CASTG 2 cut(s) 39, 103
TseI GCWGC 1 cut(s) 28
TspDTI ATGAA 2 cut(s) 201, 207
TspRI CASTG 2 cut(s) 39, 103
XapI RAATTY 1 cut(s) 127
XcmI CCANNNNNNNNNTGG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.